USP21

USP21 siRNA
20-abx905982
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
USP21 siRNA
20-abx939192
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
USP21 siRNA
20-abx939193
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
USP21 Antibody
46698-100ul 100ul
EUR 252
anti-USP21
YF-PA26021 50 ul
EUR 334
Description: Mouse polyclonal to USP21
USP21 Conjugated Antibody
C46698 100ul
EUR 397
anti- USP21 antibody
FNab09318 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:2000
  • IHC: 1:20-1:200
  • Immunogen: ubiquitin specific peptidase 21
  • Uniprot ID: Q9UK80
  • Gene ID: 27005
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against USP21
Anti-USP21 Antibody
A06639 100ug/200ul
EUR 397
Description: Goat Polyclonal USP21 Antibody. Validated in WB and tested in Human, Mouse, Rat.
USP21 Rabbit pAb
A16663-100ul 100 ul
EUR 308
USP21 Rabbit pAb
A16663-200ul 200 ul
EUR 459
USP21 Rabbit pAb
A16663-20ul 20 ul
EUR 183
USP21 Rabbit pAb
A16663-50ul 50 ul
EUR 223
USP21 Rabbit pAb
A9312-100ul 100 ul
EUR 308
USP21 Rabbit pAb
A9312-200ul 200 ul
EUR 459
USP21 Rabbit pAb
A9312-20ul 20 ul Ask for price
USP21 Rabbit pAb
A9312-50ul 50 ul Ask for price
USP21 cloning plasmid
CSB-CL891945HU-10ug 10ug
EUR 430
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1146
  • Sequence: atgatatccgcccggtcctctgagcctttctactctgatgacaagatggctcatcacacactccttctgggctctggtcatgttggccttcgaaacctgggaaacacgtgcttcctgaatgctgtgctgcagtgtctgagcagcactcgacctcttcgggacttctgtctgagaa
  • Show more
Description: A cloning plasmid for the USP21 gene.
Anti-USP21 antibody
PAab09318 100 ug
EUR 412
Anti-USP21 antibody
STJ71619 100 µg
EUR 260
Anti-USP21 antibody
STJ111651 100 µl
EUR 277
Description: This gene encodes a member of the C19 peptidase family, also known as family 2 of ubiquitin carboxy-terminal hydrolases. The encoded protein cleaves ubiquitin from ubiquitinated proteins for recycling in intracellular protein degradation. The encoded protein is also able to release NEDD8, a ubiquitin-like protein, from NEDD8-conjugated proteins. This gene has been referred to as USP16 and USP23 but is now known as USP21. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.
Anti-USP21 antibody
STJ119092 100 µl
EUR 277
Anti-USP21 (3D10)
YF-MA18143 100 ug
EUR 363
Description: Mouse monoclonal to USP21
Polyclonal USP21 Antibody (Center)
APR04568G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP21 (Center). This antibody is tested and proven to work in the following applications:
Mouse USP21 shRNA Plasmid
20-abx974054
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
USP21 ELISA KIT|Human
EF004125 96 Tests
EUR 689
Bovine USP21 ELISA KIT
ELI-51359b 96 Tests
EUR 928
Human USP21 shRNA Plasmid
20-abx958918
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat USP21 shRNA Plasmid
20-abx991164
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
USP21 Recombinant Protein (Human)
RP034099 100 ug Ask for price
USP21 Recombinant Protein (Rat)
RP236063 100 ug Ask for price
USP21 Recombinant Protein (Mouse)
RP183377 100 ug Ask for price
Polyclonal USP21 Antibody (N-Term)
APG00552G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human USP21 (N-Term). This antibody is tested and proven to work in the following applications:
Polyclonal USP21 Antibody (N-term)
APR03466G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP21 (N-term). This antibody is tested and proven to work in the following applications:
Polyclonal USP21 Antibody (C-term)
APR04837G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP21 (C-term). This antibody is tested and proven to work in the following applications:
Usp21 ORF Vector (Rat) (pORF)
ORF078689 1.0 ug DNA
EUR 506
USP21 ORF Vector (Human) (pORF)
ORF011367 1.0 ug DNA
EUR 95
Usp21 ORF Vector (Mouse) (pORF)
ORF061127 1.0 ug DNA
EUR 506
pGEX-6P-1-USP21 Plasmid
PVTB00744-1a 2 ug
EUR 356
Polyclonal Usp21 Antibody - N-terminal region
APR01242G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Usp21 - N-terminal region. This antibody is tested and proven to work in the following applications:
Polyclonal USP21 Antibody (N-term P31)
APR04838G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP21 (N-term P31). This antibody is tested and proven to work in the following applications:
USP21 sgRNA CRISPR Lentivector set (Human)
K2599101 3 x 1.0 ug
EUR 339
Usp21 sgRNA CRISPR Lentivector set (Mouse)
K3479201 3 x 1.0 ug
EUR 339
Usp21 sgRNA CRISPR Lentivector set (Rat)
K7495501 3 x 1.0 ug
EUR 339
Ubiquitin Carboxyl-Terminal Hydrolase 21 (USP21) Antibody
20-abx124607
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 21 (USP21) Antibody
abx036161-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 21 (USP21) Antibody
abx025860-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 21 (USP21) Antibody
abx025860-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 21 (USP21) Antibody
abx031499-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 21 (USP21) Antibody
abx031499-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 21 (USP21) Antibody
abx031553-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 21 (USP21) Antibody
abx031553-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 21 (USP21) Antibody
abx431902-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.
Ubiquitin Carboxyl-Terminal Hydrolase 21 (USP21) Antibody
abx239318-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
USP21 sgRNA CRISPR Lentivector (Human) (Target 1)
K2599102 1.0 ug DNA
EUR 154
USP21 sgRNA CRISPR Lentivector (Human) (Target 2)
K2599103 1.0 ug DNA
EUR 154
USP21 sgRNA CRISPR Lentivector (Human) (Target 3)
K2599104 1.0 ug DNA
EUR 154
Usp21 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3479202 1.0 ug DNA
EUR 154
Usp21 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3479203 1.0 ug DNA
EUR 154
Usp21 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3479204 1.0 ug DNA
EUR 154
Usp21 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7495502 1.0 ug DNA
EUR 154
Usp21 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7495503 1.0 ug DNA
EUR 154
Usp21 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7495504 1.0 ug DNA
EUR 154
USP21 Protein Vector (Human) (pPB-C-His)
PV045465 500 ng
EUR 329
USP21 Protein Vector (Human) (pPB-N-His)
PV045466 500 ng
EUR 329
USP21 Protein Vector (Human) (pPM-C-HA)
PV045467 500 ng
EUR 329
USP21 Protein Vector (Human) (pPM-C-His)
PV045468 500 ng
EUR 329
USP21 Protein Vector (Rat) (pPB-C-His)
PV314754 500 ng
EUR 603
USP21 Protein Vector (Rat) (pPB-N-His)
PV314755 500 ng
EUR 603
USP21 Protein Vector (Rat) (pPM-C-HA)
PV314756 500 ng
EUR 603
USP21 Protein Vector (Rat) (pPM-C-His)
PV314757 500 ng
EUR 603
USP21 Protein Vector (Mouse) (pPB-C-His)
PV244506 500 ng
EUR 603
USP21 Protein Vector (Mouse) (pPB-N-His)
PV244507 500 ng
EUR 603
USP21 Protein Vector (Mouse) (pPM-C-HA)
PV244508 500 ng
EUR 603
USP21 Protein Vector (Mouse) (pPM-C-His)
PV244509 500 ng
EUR 603
Usp21 3'UTR GFP Stable Cell Line
TU171655 1.0 ml Ask for price