TIMM50

TIMM50 siRNA
20-abx936809
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TIMM50 Antibody
1-CSB-PA674736ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TIMM50. Recognizes TIMM50 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
anti- TIMM50 antibody
FNab08702 100µg
EUR 548.75
  • Immunogen: translocase of inner mitochondrial membrane 50 homolog(S. cerevisiae)
  • Uniprot ID: Q3ZCQ8
  • Gene ID: 92609
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against TIMM50
TIMM50 Rabbit pAb
A9991-100ul 100 ul
EUR 308
TIMM50 Rabbit pAb
A9991-200ul 200 ul
EUR 459
TIMM50 Rabbit pAb
A9991-20ul 20 ul
EUR 183
TIMM50 Rabbit pAb
A9991-50ul 50 ul
EUR 223
TIMM50 Polyclonal Antibody
31800-100ul 100ul
EUR 252
TIMM50 Polyclonal Antibody
31800-50ul 50ul
EUR 187
TIMM50 cloning plasmid
CSB-CL674736HU-10ug 10ug
EUR 493
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1371
  • Sequence: ATGGCCTCAGCTTTATCTCTGGGCAATAAGTGTGATCCCTTCCTTCGCTGCGTCCTTTGCAGGGGCGGTGGCGCTCTGCAAGGCCCAAGGGGGCGTGGTCCAGATGACTTTGAATCCCAGTTGTCGCCCCCAGGGTCAGCCAGGAGACTAGTCAGAAGCAAACGCGCCTGCGGCA
  • Show more
Description: A cloning plasmid for the TIMM50 gene.
Anti-TIMM50 antibody
PAab08702 100 ug
EUR 386
Anti-TIMM50 antibody
STJ112032 100 µl
EUR 277
anti-Anti-TIMM50
YF-PA26786 50 ul
EUR 334
Description: Mouse polyclonal to Anti-TIMM50
TIMM50 Polyclonal Conjugated Antibody
C31800 100ul
EUR 397
Mouse TIMM50 shRNA Plasmid
20-abx975657
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human TIMM50 shRNA Plasmid
20-abx964151
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse Timm50 ELISA KIT
ELI-22886m 96 Tests
EUR 865
TIMM50 ELISA KIT|Human
EF003616 96 Tests
EUR 689
Bovine TIMM50 ELISA KIT
ELI-45876b 96 Tests
EUR 928
Human TIMM50 ELISA KIT
ELI-41966h 96 Tests
EUR 824
TIMM50 Recombinant Protein (Human)
RP044149 100 ug Ask for price
TIMM50 Recombinant Protein (Mouse)
RP178787 100 ug Ask for price
Polyclonal TIMM50 Antibody (N-term)
APR10448G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TIMM50 (N-term). This antibody is tested and proven to work in the following applications:
Polyclonal TIMM50 Antibody (N-term)
APR10449G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TIMM50 (N-term). This antibody is tested and proven to work in the following applications:
Timm50 ORF Vector (Mouse) (pORF)
ORF059597 1.0 ug DNA
EUR 506
TIMM50 ORF Vector (Human) (pORF)
ORF014717 1.0 ug DNA
EUR 354
TIMM50 sgRNA CRISPR Lentivector set (Human)
K2375801 3 x 1.0 ug
EUR 339
Timm50 sgRNA CRISPR Lentivector set (Mouse)
K4946601 3 x 1.0 ug
EUR 339
TIMM50 sgRNA CRISPR Lentivector (Human) (Target 1)
K2375802 1.0 ug DNA
EUR 154
TIMM50 sgRNA CRISPR Lentivector (Human) (Target 2)
K2375803 1.0 ug DNA
EUR 154
TIMM50 sgRNA CRISPR Lentivector (Human) (Target 3)
K2375804 1.0 ug DNA
EUR 154
Timm50 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4946602 1.0 ug DNA
EUR 154
Timm50 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4946603 1.0 ug DNA
EUR 154
Timm50 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4946604 1.0 ug DNA
EUR 154
TIMM50 Protein Vector (Human) (pPB-C-His)
PV058865 500 ng
EUR 481
TIMM50 Protein Vector (Human) (pPB-N-His)
PV058866 500 ng
EUR 481
TIMM50 Protein Vector (Human) (pPM-C-HA)
PV058867 500 ng
EUR 481
TIMM50 Protein Vector (Human) (pPM-C-His)
PV058868 500 ng
EUR 481
TIMM50 Protein Vector (Mouse) (pPB-C-His)
PV238386 500 ng
EUR 603
TIMM50 Protein Vector (Mouse) (pPB-N-His)
PV238387 500 ng
EUR 603
TIMM50 Protein Vector (Mouse) (pPM-C-HA)
PV238388 500 ng
EUR 603
TIMM50 Protein Vector (Mouse) (pPM-C-His)
PV238389 500 ng
EUR 603
Timm50 3'UTR GFP Stable Cell Line
TU170504 1.0 ml Ask for price
TIMM50 3'UTR GFP Stable Cell Line
TU075600 1.0 ml
EUR 1394
Timm50 3'UTR Luciferase Stable Cell Line
TU120504 1.0 ml Ask for price
TIMM50 3'UTR Luciferase Stable Cell Line
TU025600 1.0 ml
EUR 1394
Mitochondrial Import Inner Membrane Translocase Subunit TIM50 (TIMM50) Antibody
20-abx135911
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Mitochondrial Import Inner Membrane Translocase Subunit TIM50 (TIMM50) Antibody
abx030749-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Mitochondrial Import Inner Membrane Translocase Subunit TIM50 (TIMM50) Antibody
abx030749-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Mitochondrial Import Inner Membrane Translocase Subunit TIM50 (TIMM50) Antibody
20-abx322079
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Mitochondrial Import Inner Membrane Translocase Subunit TIM50 (TIMM50) Antibody
abx238702-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
TIMM50 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2375805 3 x 1.0 ug
EUR 376
Timm50 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4946605 3 x 1.0 ug
EUR 376
Rat Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) ELISA kit
E02M0110-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) ELISA kit
E02M0110-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) ELISA kit
E02M0110-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) ELISA kit
E03M0110-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) ELISA kit
E03M0110-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) ELISA kit
E03M0110-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) ELISA kit
E01M0110-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) ELISA kit
E01M0110-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) ELISA kit
E01M0110-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) ELISA kit
E04M0110-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) ELISA kit
E04M0110-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) ELISA kit
E04M0110-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) ELISA kit
E08M0110-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) ELISA kit
E08M0110-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) ELISA kit
E08M0110-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) ELISA kit
E07M0110-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) ELISA kit
E07M0110-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) ELISA kit
E07M0110-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) ELISA kit
E06M0110-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) ELISA kit
E06M0110-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) ELISA kit
E06M0110-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) ELISA kit
E09M0110-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Mitochondrial import inner membrane translocase subunit TIM50(TIMM50) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.