target comt

Human Catechol-O-Methyltransferase (COMT) ELISA Kit
DLR-COMT-Hu-96T 96T
EUR 673
  • Should the Human Catechol-O-Methyltransferase (COMT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Catechol-O-Methyltransferase (COMT) in samples from tissue homogenates, cell lysates or other biological fluids.
Mouse Catechol-O-Methyltransferase (COMT) ELISA Kit
DLR-COMT-Mu-48T 48T
EUR 527
  • Should the Mouse Catechol-O-Methyltransferase (COMT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Catechol-O-Methyltransferase (COMT) in samples from tissue homogenates, cell lysates or other biological fluids.
Mouse Catechol-O-Methyltransferase (COMT) ELISA Kit
DLR-COMT-Mu-96T 96T
EUR 688
  • Should the Mouse Catechol-O-Methyltransferase (COMT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Catechol-O-Methyltransferase (COMT) in samples from tissue homogenates, cell lysates or other biological fluids.
Rat Catechol-O-Methyltransferase (COMT) ELISA Kit
DLR-COMT-Ra-48T 48T
EUR 549
  • Should the Rat Catechol-O-Methyltransferase (COMT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Catechol-O-Methyltransferase (COMT) in samples from serum, plasma, tissue homogenates or other biological fluids.
Rat Catechol-O-Methyltransferase (COMT) ELISA Kit
DLR-COMT-Ra-96T 96T
EUR 718
  • Should the Rat Catechol-O-Methyltransferase (COMT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Catechol-O-Methyltransferase (COMT) in samples from serum, plasma, tissue homogenates or other biological fluids.
Human Catechol-O-Methyltransferase (COMT) ELISA Kit
RDR-COMT-Hu-48Tests 48 Tests
EUR 544
Human Catechol-O-Methyltransferase (COMT) ELISA Kit
RDR-COMT-Hu-96Tests 96 Tests
EUR 756
Mouse Catechol-O-Methyltransferase (COMT) ELISA Kit
RDR-COMT-Mu-48Tests 48 Tests
EUR 557
Mouse Catechol-O-Methyltransferase (COMT) ELISA Kit
RDR-COMT-Mu-96Tests 96 Tests
EUR 774
Rat Catechol-O-Methyltransferase (COMT) ELISA Kit
RDR-COMT-Ra-48Tests 48 Tests
EUR 583
Rat Catechol-O-Methyltransferase (COMT) ELISA Kit
RDR-COMT-Ra-96Tests 96 Tests
EUR 811
Human Catechol-O-Methyltransferase (COMT) ELISA Kit
RD-COMT-Hu-48Tests 48 Tests
EUR 521
Human Catechol-O-Methyltransferase (COMT) ELISA Kit
RD-COMT-Hu-96Tests 96 Tests
EUR 723
Mouse Catechol-O-Methyltransferase (COMT) ELISA Kit
RD-COMT-Mu-48Tests 48 Tests
EUR 533
Mouse Catechol-O-Methyltransferase (COMT) ELISA Kit
RD-COMT-Mu-96Tests 96 Tests
EUR 740
Rat Catechol-O-Methyltransferase (COMT) ELISA Kit
RD-COMT-Ra-48Tests 48 Tests
EUR 557
Rat Catechol-O-Methyltransferase (COMT) ELISA Kit
RD-COMT-Ra-96Tests 96 Tests
EUR 775
Comt/ Rat Comt ELISA Kit
ELI-46977r 96 Tests
EUR 886
COMT protein
30R-1264 100 ug
EUR 586
Description: Purified recombinant Human COMT protein
COMT antibody
70R-16509 50 ul
EUR 435
Description: Rabbit polyclonal COMT antibody
COMT Antibody
34554-100ul 100ul
EUR 252
COMT Antibody
34554-50ul 50ul
EUR 187
COMT antibody
38744-100ul 100ul
EUR 252
COMT Antibody
49955-100ul 100ul
EUR 333
COMT Antibody
49955-50ul 50ul
EUR 239
COMT Antibody
43047-100ul 100ul
EUR 252
COMT Antibody
1-CSB-PA005779GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against COMT. Recognizes COMT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF
COMT Antibody
DF3905 200ul
EUR 304
Description: COMT Antibody detects endogenous levels of total COMT.
COMT Antibody
CSB-PA443797-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against COMT. Recognizes COMT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
COMT Antibody
CSB-PA443797-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against COMT. Recognizes COMT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
COMT antibody
70R-36519 100 ug
EUR 327
Description: Rabbit polyclonal COMT antibody
COMT antibody
70R-49578 100 ul
EUR 244
Description: Purified Polyclonal COMT antibody
COMT antibody
70R-7143 50 ug
EUR 467
Description: Rabbit polyclonal COMT antibody raised against the middle region of COMT
COMT Antibody
1-CSB-PA007149
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against COMT. Recognizes COMT from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.IHC:1/200-1/1000.ELISA:1/20000
COMT siRNA
20-abx901187
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
COMT siRNA
20-abx912504
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
COMT siRNA
20-abx912505
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
COMT Antibody
ABD3905 100 ug
EUR 438
pOTB7-COMT
PVT18329 2 ug
EUR 231
anti-COMT
YF-PA11031 50 ul
EUR 363
Description: Mouse polyclonal to COMT
anti-COMT
YF-PA11032 50 ug
EUR 363
Description: Mouse polyclonal to COMT
anti-COMT
YF-PA11033 100 ul
EUR 403
Description: Rabbit polyclonal to COMT
anti-COMT
YF-PA11034 100 ug
EUR 403
Description: Rabbit polyclonal to COMT
anti-COMT
YF-PA23490 50 ul
EUR 334
Description: Mouse polyclonal to COMT
COMT Rabbit pAb
A1294-100ul 100 ul
EUR 308
COMT Rabbit pAb
A1294-200ul 200 ul
EUR 459
COMT Rabbit pAb
A1294-20ul 20 ul
EUR 183
COMT Rabbit pAb
A1294-50ul 50 ul
EUR 223
COMT Blocking Peptide
33R-7005 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of COMT antibody, catalog no. 70R-7143
Human COMT Antibody
32622-05111 150 ug
EUR 261
COMT Blocking Peptide
DF3905-BP 1mg
EUR 195
Anti-COMT Antibody
A00464 100ug/vial
EUR 294
COMT Blocking Peptide
20-abx062453
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
COMT Conjugated Antibody
C49955 100ul
EUR 397
Polyclonal COMT Antibody
APG02693G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human COMT . This antibody is tested and proven to work in the following applications:
COMT Conjugated Antibody
C43047 100ul
EUR 397
COMT Conjugated Antibody
C34554 100ul
EUR 397
COMT cloning plasmid
CSB-CL005779HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 816
  • Sequence: atgccggaggccccgcctctgctgttggcagctgtgttgctgggcctggtgctgctggtggtgctgctgctgcttctgaggcactggggctggggcctgtgccttatcggctggaacgagttcatcctgcagcccatccacaacctgctcatgggtgacaccaaggagcagcgcat
  • Show more
Description: A cloning plasmid for the COMT gene.
COMT cloning plasmid
CSB-CL005779HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 549
  • Sequence: atgaacgtgggcgacaagaaaggcaagatcgtggacgccgtgattcaggagcaccagccctccgtgctgctggagctgggggcctactgtggctactcagctgtgcgcatggcccgcctgctgtcaccaggggcgaggctcatcaccatcgagatcaaccccgactgtgccgccat
  • Show more
Description: A cloning plasmid for the COMT gene.
COMT Polyclonal Antibody
ABP53762-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human COMT at AA rangle: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of COMT from Human. This COMT antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human COMT at AA rangle: 30-110
COMT Polyclonal Antibody
ABP53762-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human COMT at AA rangle: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of COMT from Human. This COMT antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human COMT at AA rangle: 30-110
COMT Polyclonal Antibody
ABP53762-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human COMT at AA rangle: 30-110
  • Applications tips:
Description: A polyclonal antibody for detection of COMT from Human. This COMT antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human COMT at AA rangle: 30-110
COMT Rabbit mAb
A4435-100ul 100 ul
EUR 410
COMT Rabbit mAb
A4435-200ul 200 ul
EUR 571
COMT Rabbit mAb
A4435-20ul 20 ul
EUR 221
COMT Rabbit mAb
A4435-50ul 50 ul
EUR 287
COMT Rabbit pAb
A6200-100ul 100 ul
EUR 308
COMT Rabbit pAb
A6200-200ul 200 ul
EUR 459
COMT Rabbit pAb
A6200-20ul 20 ul
EUR 183
COMT Rabbit pAb
A6200-50ul 50 ul
EUR 223
COMT Polyclonal Antibody
ES4761-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against COMT from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
COMT Polyclonal Antibody
ES4761-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against COMT from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
anti- COMT antibody
FNab01856 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: catechol-O-methyltransferase
  • Uniprot ID: P21964
  • Gene ID: 1312
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against COMT
Anti-COMT Antibody
PA2203 100ug/vial
EUR 334
Anti-COMT antibody
PAab01856 100 ug
EUR 355