SLC35C1

SLC35C1 Antibody
1-CSB-PA839285LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC35C1. Recognizes SLC35C1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500
SLC35C1 Antibody
20-abx309327
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SLC35C1 siRNA
20-abx933892
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SLC35C1 siRNA
20-abx933893
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
pOTB7-SLC35C1
PVT18908 2 ug
EUR 231
SLC35C1 Blocking Peptide
33R-9287 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SLC35C1 antibody, catalog no. 70R-1723
SLC35C1 Antibody (HRP)
20-abx309328
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SLC35C1 Antibody (FITC)
20-abx309329
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SLC35C1 Antibody (Biotin)
20-abx309330
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SLC35C1 cloning plasmid
CSB-CL839285HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1095
  • Sequence: atgaatagggcccctctgaagcggtccaggatcctgcacatggcgctgaccggggcctcagacccctctgcagaggcagaggccaacggggagaagccctttctgctgcgggcattgcagatcgcgctggtggtctccctctactcggtcacctccatctccatggtgttcctta
  • Show more
Description: A cloning plasmid for the SLC35C1 gene.
SLC35C1 Polyclonal Antibody
A60982 100 µg
EUR 570.55
Description: The best epigenetics products
SLC35C1 Antibody, HRP conjugated
1-CSB-PA839285LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC35C1. Recognizes SLC35C1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SLC35C1 Antibody, FITC conjugated
1-CSB-PA839285LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC35C1. Recognizes SLC35C1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SLC35C1 Antibody, Biotin conjugated
1-CSB-PA839285LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC35C1. Recognizes SLC35C1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Human SLC35C1 shRNA Plasmid
20-abx960673
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse SLC35C1 shRNA Plasmid
20-abx981624
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SLC35C1 Recombinant Protein (Human)
RP029044 100 ug Ask for price
SLC35C1 Recombinant Protein (Rat)
RP229457 100 ug Ask for price
SLC35C1 Recombinant Protein (Mouse)
RP172958 100 ug Ask for price
SLC35C1 Recombinant Protein (Mouse)
RP172961 100 ug Ask for price
SLC35C1 Polyclonal Antibody, Biotin Conjugated
A60983 100 µg
EUR 570.55
Description: kits suitable for this type of research
SLC35C1 Polyclonal Antibody, FITC Conjugated
A60984 100 µg
EUR 570.55
Description: fast delivery possible
SLC35C1 Polyclonal Antibody, HRP Conjugated
A60985 100 µg
EUR 570.55
Description: reagents widely cited
Slc35c1 ORF Vector (Rat) (pORF)
ORF076487 1.0 ug DNA
EUR 506
SLC35C1 ORF Vector (Human) (pORF)
ORF009682 1.0 ug DNA
EUR 95
Slc35c1 ORF Vector (Mouse) (pORF)
ORF057654 1.0 ug DNA
EUR 506
Slc35c1 ORF Vector (Mouse) (pORF)
ORF057655 1.0 ug DNA
EUR 506
Polyclonal SLC35C1 antibody - N-terminal region
APR10093G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SLC35C1 - N-terminal region. This antibody is tested and proven to work in the following applications:
Slc35c1 sgRNA CRISPR Lentivector set (Rat)
K6719001 3 x 1.0 ug
EUR 339
SLC35C1 sgRNA CRISPR Lentivector set (Human)
K2186101 3 x 1.0 ug
EUR 339
Slc35c1 sgRNA CRISPR Lentivector set (Mouse)
K3567801 3 x 1.0 ug
EUR 339
Slc35c1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6719002 1.0 ug DNA
EUR 154
Slc35c1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6719003 1.0 ug DNA
EUR 154
Slc35c1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6719004 1.0 ug DNA
EUR 154
SLC35C1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2186102 1.0 ug DNA
EUR 154
SLC35C1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2186103 1.0 ug DNA
EUR 154
SLC35C1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2186104 1.0 ug DNA
EUR 154
Slc35c1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3567802 1.0 ug DNA
EUR 154
Slc35c1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3567803 1.0 ug DNA
EUR 154
Slc35c1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3567804 1.0 ug DNA
EUR 154
SLC35C1 Protein Vector (Rat) (pPB-C-His)
PV305946 500 ng
EUR 603
SLC35C1 Protein Vector (Rat) (pPB-N-His)
PV305947 500 ng
EUR 603
SLC35C1 Protein Vector (Rat) (pPM-C-HA)
PV305948 500 ng
EUR 603
SLC35C1 Protein Vector (Rat) (pPM-C-His)
PV305949 500 ng
EUR 603
SLC35C1 Protein Vector (Human) (pPB-C-His)
PV038725 500 ng
EUR 329
SLC35C1 Protein Vector (Human) (pPB-N-His)
PV038726 500 ng
EUR 329
SLC35C1 Protein Vector (Human) (pPM-C-HA)
PV038727 500 ng
EUR 329
SLC35C1 Protein Vector (Human) (pPM-C-His)
PV038728 500 ng
EUR 329
SLC35C1 Protein Vector (Mouse) (pPB-C-His)
PV230614 500 ng
EUR 603
SLC35C1 Protein Vector (Mouse) (pPB-N-His)
PV230615 500 ng
EUR 603
SLC35C1 Protein Vector (Mouse) (pPM-C-HA)
PV230616 500 ng
EUR 603
SLC35C1 Protein Vector (Mouse) (pPM-C-His)
PV230617 500 ng
EUR 603
SLC35C1 Protein Vector (Mouse) (pPB-C-His)
PV230618 500 ng
EUR 603
SLC35C1 Protein Vector (Mouse) (pPB-N-His)
PV230619 500 ng
EUR 603
SLC35C1 Protein Vector (Mouse) (pPM-C-HA)
PV230620 500 ng
EUR 603
SLC35C1 Protein Vector (Mouse) (pPM-C-His)
PV230621 500 ng
EUR 603
Slc35c1 3'UTR Luciferase Stable Cell Line
TU119092 1.0 ml Ask for price
Slc35c1 3'UTR GFP Stable Cell Line
TU169092 1.0 ml Ask for price
Slc35c1 3'UTR Luciferase Stable Cell Line
TU220616 1.0 ml Ask for price
Slc35c1 3'UTR GFP Stable Cell Line
TU270616 1.0 ml Ask for price
SLC35C1 3'UTR GFP Stable Cell Line
TU073578 1.0 ml
EUR 1521
SLC35C1 3'UTR Luciferase Stable Cell Line
TU023578 1.0 ml
EUR 1521
Mouse GDP- fucose transporter 1, Slc35c1 ELISA KIT
ELI-27557m 96 Tests
EUR 865
Human GDP- fucose transporter 1, SLC35C1 ELISA KIT
ELI-07916h 96 Tests
EUR 824
Bovine GDP- fucose transporter 1, SLC35C1 ELISA KIT
ELI-48333b 96 Tests
EUR 928
SLC35C1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV623761 1.0 ug DNA
EUR 682
SLC35C1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV623765 1.0 ug DNA
EUR 682
SLC35C1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV623766 1.0 ug DNA
EUR 682
Slc35c1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6719005 3 x 1.0 ug
EUR 376
SLC35C1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2186105 3 x 1.0 ug
EUR 376
Slc35c1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3567805 3 x 1.0 ug
EUR 376
SLC35C1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV623762 1.0 ug DNA
EUR 682
SLC35C1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV623763 1.0 ug DNA
EUR 740
SLC35C1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV623764 1.0 ug DNA
EUR 740
Slc35c1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6719006 1.0 ug DNA
EUR 167
Slc35c1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6719007 1.0 ug DNA
EUR 167
Slc35c1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6719008 1.0 ug DNA
EUR 167
SLC35C1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2186106 1.0 ug DNA
EUR 167
SLC35C1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2186107 1.0 ug DNA
EUR 167
SLC35C1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2186108 1.0 ug DNA
EUR 167
Slc35c1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3567806 1.0 ug DNA
EUR 167
Slc35c1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3567807 1.0 ug DNA
EUR 167
Slc35c1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3567808 1.0 ug DNA
EUR 167