  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NEU1 antibody

38805-100ul 100ul
EUR 252

NEU1 antibody

70R-1866 100 ug
EUR 377
Description: Rabbit polyclonal NEU1 antibody

NEU1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NEU1. Recognizes NEU1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

NEU1 Conjugated Antibody

C38805 100ul
EUR 397

NEU1 Polyclonal Antibody

A64180 100 µg
EUR 570.55
Description: fast delivery possible

NEU1 Rabbit pAb

A6299-100ul 100 ul
EUR 308

NEU1 Rabbit pAb

A6299-200ul 200 ul
EUR 459

NEU1 Rabbit pAb

A6299-20ul 20 ul
EUR 183

NEU1 Rabbit pAb

A6299-50ul 50 ul
EUR 223

NEU1 Blocking Peptide

33R-9913 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NEU1 antibody, catalog no. 70R-1866

NEU1 cloning plasmid

CSB-CL858714HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1248
  • Sequence: atgactggggagcgacccagcacggcgctcccggacagacgctgggggccgcggattctgggcttctggggaggctgtagggtttgggtgtttgccgcgatcttcctgctgctgtctctggcagcctcctggtccaaggctgagaacgacttcggtctggtgcagccgctggtga
  • Show more
Description: A cloning plasmid for the NEU1 gene.

Anti-NEU1 antibody

STJ28221 100 µl
EUR 277
Description: The protein encoded by this gene is a lysosomal enzyme that cleaves terminal sialic acid residues from substrates such as glycoproteins and glycolipids. In the lysosome, this enzyme is part of a heterotrimeric complex together with beta-galactosidase and cathepsin A (the latter is also referred to as 'protective protein'). Mutations in this gene can lead to sialidosis, a lysosomal storage disease that can be type 1 (cherry red spot-myoclonus syndrome or normosomatic type), which is late-onset, or type 2 (the dysmorphic type), which occurs at an earlier age with increased severity.

Sialidase-1 (Neu1) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sialidase-1 (NEU1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Sialidase-1 (NEU1) Antibody

abx031338-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Sialidase-1 (NEU1) Antibody

abx031338-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Sialidase-1 (NEU1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human NEU1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NEU1 protein (His tag)

80R-2429 100 ug
EUR 424
Description: Purified recombinant NEU1 protein (His tag)

Mouse NEU1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NEU1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NEU1. Recognizes NEU1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NEU1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NEU1. Recognizes NEU1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NEU1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NEU1. Recognizes NEU1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NEU1 Recombinant Protein (Human)

RP021085 100 ug Ask for price

NEU1 Recombinant Protein (Rat)

RP213710 100 ug Ask for price

NEU1 Recombinant Protein (Mouse)

RP153728 100 ug Ask for price

NEU1 Polyclonal Antibody, HRP Conjugated

A64181 100 µg
EUR 570.55
Description: reagents widely cited

NEU1 Polyclonal Antibody, FITC Conjugated

A64182 100 µg
EUR 570.55
Description: Ask the seller for details

NEU1 Polyclonal Antibody, Biotin Conjugated

A64183 100 µg
EUR 570.55
Description: The best epigenetics products

Sialidase 1 (NEU1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Sialidase 1 (NEU1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Sialidase 1 (NEU1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NEU1 ORF Vector (Human) (pORF)

ORF007029 1.0 ug DNA
EUR 95

Neu1 ORF Vector (Rat) (pORF)

ORF071238 1.0 ug DNA
EUR 506

Neu1 ORF Vector (Mouse) (pORF)

ORF051244 1.0 ug DNA
EUR 506

pECMV-Neu1-m-FLAG Plasmid

PVT15190 2 ug
EUR 325

NEU1 ELISA Kit (Human) (OKCA00814)

OKCA00814 96 Wells
EUR 917
Description: Description of target: Catalyzes the removal of sialic acid (N-acetylneuraminic acid) moities from glycoproteins and glycolipids. To be active, it is strictly dependent on its presence in the multienzyme complex. Appears to have a preference for alpha 2-3 and alpha 2-6 sialyl linkage.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

Mouse Sialidase- 1, Neu1 ELISA KIT

ELI-22137m 96 Tests
EUR 865

Human Sialidase- 1, NEU1 ELISA KIT

ELI-23188h 96 Tests
EUR 824

Porcine Sialidase- 1, NEU1 ELISA KIT

ELI-44056p 96 Tests
EUR 928

Bovine Sialidase- 1, NEU1 ELISA KIT

ELI-39514b 96 Tests
EUR 928

NEU1 sgRNA CRISPR Lentivector set (Human)

K1418301 3 x 1.0 ug
EUR 339

Neu1 sgRNA CRISPR Lentivector set (Mouse)

K3003201 3 x 1.0 ug
EUR 339

Neu1 sgRNA CRISPR Lentivector set (Mouse)

K3856801 3 x 1.0 ug
EUR 339

Neu1 sgRNA CRISPR Lentivector set (Rat)

K6891401 3 x 1.0 ug
EUR 339

NEU1 Sialidase 1 Human Recombinant Protein

PROTQ99519 Regular: 20ug
EUR 317
Description: NEU1 Human Recombinant produced in E. coli is a single polypeptide chain containing 393 amino acids (48-415) and having a molecular mass of 42.9 kDa.;NEU1 is fused to a 25 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

NEU1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1418302 1.0 ug DNA
EUR 154

NEU1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1418303 1.0 ug DNA
EUR 154

NEU1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1418304 1.0 ug DNA
EUR 154

Neu1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3003202 1.0 ug DNA
EUR 154

Neu1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3003203 1.0 ug DNA
EUR 154

Neu1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3003204 1.0 ug DNA
EUR 154

Neu1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3856802 1.0 ug DNA
EUR 154

Neu1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3856803 1.0 ug DNA
EUR 154

Neu1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3856804 1.0 ug DNA
EUR 154

ELISA kit for Pig Sialidase-1 (NEU1)

KTE80181-48T 48T
EUR 354
  • Neuraminidase, or lysosomal sialidase , has a dual physiologic function: it participates in intralysosomal catabolism of sialated glycoconjugates and is involved in cellular immune response. The enzyme occurs in a complex with beta-galactosidase (GLB
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Sialidase-1 (NEU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Sialidase-1 (NEU1)

KTE80181-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Neuraminidase, or lysosomal sialidase , has a dual physiologic function: it participates in intralysosomal catabolism of sialated glycoconjugates and is involved in cellular immune response. The enzyme occurs in a complex with beta-galactosidase (GLB
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Sialidase-1 (NEU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Pig Sialidase-1 (NEU1)

KTE80181-96T 96T
EUR 572
  • Neuraminidase, or lysosomal sialidase , has a dual physiologic function: it participates in intralysosomal catabolism of sialated glycoconjugates and is involved in cellular immune response. The enzyme occurs in a complex with beta-galactosidase (GLB
  • Show more
Description: Quantitative sandwich ELISA for measuring Pig Sialidase-1 (NEU1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Neu1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6891402 1.0 ug DNA
EUR 154

Neu1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6891403 1.0 ug DNA
EUR 154

Neu1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6891404 1.0 ug DNA
EUR 154

Recombinant Human NEU1 Protein, His, E.coli-1mg

QP12830-1mg 1mg
EUR 3655

Recombinant Human NEU1 Protein, His, E.coli-20ug

QP12830-20ug 20ug
EUR 201

Recombinant Human NEU1 Protein, His, E.coli-5ug

QP12830-5ug 5ug
EUR 155

NEU1 Protein Vector (Rat) (pPB-C-His)

PV284950 500 ng
EUR 603

NEU1 Protein Vector (Rat) (pPB-N-His)

PV284951 500 ng
EUR 603

NEU1 Protein Vector (Rat) (pPM-C-HA)

PV284952 500 ng
EUR 603

NEU1 Protein Vector (Rat) (pPM-C-His)

PV284953 500 ng
EUR 603

NEU1 Protein Vector (Human) (pPB-C-His)

PV028113 500 ng
EUR 329

NEU1 Protein Vector (Human) (pPB-N-His)

PV028114 500 ng
EUR 329

NEU1 Protein Vector (Human) (pPM-C-HA)

PV028115 500 ng
EUR 329

NEU1 Protein Vector (Human) (pPM-C-His)

PV028116 500 ng
EUR 329

NEU1 Protein Vector (Mouse) (pPB-C-His)

PV204974 500 ng
EUR 603

NEU1 Protein Vector (Mouse) (pPB-N-His)

PV204975 500 ng
EUR 603

NEU1 Protein Vector (Mouse) (pPM-C-HA)

PV204976 500 ng
EUR 603

NEU1 Protein Vector (Mouse) (pPM-C-His)

PV204977 500 ng
EUR 603

Neu1 3'UTR GFP Stable Cell Line

TU164005 1.0 ml Ask for price

Neu1 3'UTR Luciferase Stable Cell Line

TU213900 1.0 ml Ask for price

NEU1 3'UTR Luciferase Stable Cell Line

TU015590 1.0 ml
EUR 1394

Neu1 3'UTR Luciferase Stable Cell Line

TU114005 1.0 ml Ask for price

NEU1 3'UTR GFP Stable Cell Line

TU065590 1.0 ml
EUR 1394

Neu1 3'UTR GFP Stable Cell Line

TU263900 1.0 ml Ask for price

NEU1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV700201 1.0 ug DNA
EUR 682

NEU1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV700205 1.0 ug DNA
EUR 682

NEU1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV700206 1.0 ug DNA
EUR 682

NEU1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1418305 3 x 1.0 ug
EUR 376

Neu1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3003205 3 x 1.0 ug
EUR 376

Neu1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3856805 3 x 1.0 ug
EUR 376

Neu1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6891405 3 x 1.0 ug
EUR 376

NEU1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1418306 1.0 ug DNA
EUR 167

NEU1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1418307 1.0 ug DNA
EUR 167

NEU1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1418308 1.0 ug DNA
EUR 167

Neu1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3003206 1.0 ug DNA
EUR 167