msc cell

MSC-2530818

B1975-5
EUR 457

MSC siRNA

20-abx924770
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MSC siRNA

20-abx924771
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MSC Antibody

1-CSB-PA003336
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MSC. Recognizes MSC from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

MSC Antibody

1-CSB-PA015025LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MSC. Recognizes MSC from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

MSC cloning plasmid

CSB-CL015025HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 621
  • Sequence: atgtccacgggctcggtgagtgatccggaggagatggagcttcgggggctgcagcgggagtacccggtccccgcctccaagaggccgcccctccgcggcgtagagcgcagctacgcctcgcccagtgacaactcgtcggcagaggaggaggaccccgacggcgaggaggagcgctg
  • Show more
Description: A cloning plasmid for the MSC gene.

Musculin (MSC) Antibody

20-abx133243
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Musculin (MSC) Antibody

20-abx013312
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Musculin (MSC) Antibody

abx029864-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Musculin (MSC) Antibody

abx029864-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Musculin (MSC) Antibody

20-abx325767
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Musculin (MSC) Antibody

20-abx301830
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

pDONR223-MSC Plasmid

PVTB01127-1 2 ug
EUR 356

pLenti6-V5-MSC

PVT17279 2 ug
EUR 474

Anti-MSC (1D1)

YF-MA16741 100 ug
EUR 363
Description: Mouse monoclonal to MSC

Anti-MSC (4D7)

YF-MA16742 100 ug
EUR 363
Description: Mouse monoclonal to MSC

Msc 3'UTR GFP Stable Cell Line

TU163512 1.0 ml Ask for price

Msc 3'UTR Luciferase Stable Cell Line

TU213475 1.0 ml Ask for price

MSC 3'UTR Luciferase Stable Cell Line

TU014752 1.0 ml
EUR 1394

Msc 3'UTR Luciferase Stable Cell Line

TU113512 1.0 ml Ask for price

MSC 3'UTR GFP Stable Cell Line

TU064752 1.0 ml
EUR 1394

Msc 3'UTR GFP Stable Cell Line

TU263475 1.0 ml Ask for price

MSC ELISA KIT|Human

EF005304 96 Tests
EUR 689

Musculin (MSC) Antibody (HRP)

20-abx315849
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Musculin (MSC) Antibody (FITC)

20-abx315850
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Musculin (MSC) Antibody (Biotin)

20-abx315851
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human MSC shRNA Plasmid

20-abx956118
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse MSC shRNA Plasmid

20-abx971570
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MSC Antibody, HRP conjugated

1-CSB-PA015025LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MSC. Recognizes MSC from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MSC Antibody, FITC conjugated

1-CSB-PA015025LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MSC. Recognizes MSC from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MSC Antibody, Biotin conjugated

1-CSB-PA015025LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MSC. Recognizes MSC from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MSC Recombinant Protein (Human)

RP020146 100 ug Ask for price

MSC Recombinant Protein (Rat)

RP212531 100 ug Ask for price

MSC Recombinant Protein (Mouse)

RP151784 100 ug Ask for price

Anti-MSC / ABF1 antibody

STJ70022 100 µg
EUR 359

Mouse Musculin, Msc ELISA KIT

ELI-22864m 96 Tests
EUR 865

Human Musculin, MSC ELISA KIT

ELI-42338h 96 Tests
EUR 824

Human Musculin (MSC) ELISA Kit

abx385179-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Musculin (MSC) ELISA Kit

abx389942-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

MSC ORF Vector (Human) (pORF)

ORF006716 1.0 ug DNA
EUR 95

Msc ORF Vector (Mouse) (pORF)

ORF050596 1.0 ug DNA
EUR 506

Msc ORF Vector (Rat) (pORF)

ORF070845 1.0 ug DNA
EUR 506

Human Musculin(MSC)ELISA Kit  

QY-E03076 96T
EUR 361

Msc sgRNA CRISPR Lentivector set (Mouse)

K4473001 3 x 1.0 ug
EUR 339

Msc sgRNA CRISPR Lentivector set (Rat)

K6197201 3 x 1.0 ug
EUR 339

Goat Anti Human Msc Polyclonal Antibody

DPBT-67363GH 0.1 mg
EUR 861

MSC sgRNA CRISPR Lentivector set (Human)

K1348001 3 x 1.0 ug
EUR 339

CytoSelect Cell Transformation Assay (Cell Recovery Compatible), Colorimetric

CBA-135 96 assays
EUR 821
Description: CytoSelect 96-Well Cell Transformation Assays (Cell Recovery Compatible) provide a robust system for detecting transformed cells, screening cell transformation inhibitors, and determining in vitro drug sensitivity. A proprietary modified soft agar matrix allows you to either quantify cells using the included fluorescent dye, or recover the cells for further analysis.

CytoSelect Cell Transformation Assay (Cell Recovery Compatible), Colorimetric

CBA-135-5 5 x 96 assays
EUR 3356
Description: CytoSelect 96-Well Cell Transformation Assays (Cell Recovery Compatible) provide a robust system for detecting transformed cells, screening cell transformation inhibitors, and determining in vitro drug sensitivity. A proprietary modified soft agar matrix allows you to either quantify cells using the included fluorescent dye, or recover the cells for further analysis.

CytoSelect Cell Transformation Assay (Cell Recovery Compatible), Fluorometric

CBA-140 96 assays
EUR 856
Description: CytoSelect 96-Well Cell Transformation Assays (Cell Recovery Compatible) provide a robust system for detecting transformed cells, screening cell transformation inhibitors, and determining in vitro drug sensitivity. A proprietary modified soft agar matrix allows you to either quantify cells using the included fluorescent dye, or recover the cells for further analysis.

CytoSelect Cell Transformation Assay (Cell Recovery Compatible), Fluorometric

CBA-140-5 5 x 96 assays
EUR 3483
Description: CytoSelect 96-Well Cell Transformation Assays (Cell Recovery Compatible) provide a robust system for detecting transformed cells, screening cell transformation inhibitors, and determining in vitro drug sensitivity. A proprietary modified soft agar matrix allows you to either quantify cells using the included fluorescent dye, or recover the cells for further analysis.

293AD Cell Line

AD-100 1 vial
EUR 461
Description: The 293AD Cell Line is derived from the parental 293 cells but selected for attributes that increase adenovirus production, including firmer attachment and larger surface area.

293AAV Cell Line

AAV-100 1 vial
EUR 508
Description: The 293AAV Cell Line is derived from the parental 293 cells but selected for attributes that increase AAV production, including firmer attachment and larger surface area.

293LTV Cell Line

LTV-100 1 vial
EUR 508
Description: The 293LTV Cell Line is derived from the parental 293 cells but selected for attributes that increase lentiviral production, including fimrer attachment and larger surface area.

293RTV Cell Line

RV-100 1 vial
EUR 508
Description: The 293RTV Cell Line is derived from the parental 293 cells but selected for attributes that increase retroviral production, including fimrer attachment and larger surface area.

Msc ELISA Kit| Mouse Musculin ELISA Kit

EF015581 96 Tests
EUR 689

Msc sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4473002 1.0 ug DNA
EUR 154

Msc sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4473003 1.0 ug DNA
EUR 154

Msc sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4473004 1.0 ug DNA
EUR 154

Msc sgRNA CRISPR Lentivector (Rat) (Target 1)

K6197202 1.0 ug DNA
EUR 154

Msc sgRNA CRISPR Lentivector (Rat) (Target 2)

K6197203 1.0 ug DNA
EUR 154

Msc sgRNA CRISPR Lentivector (Rat) (Target 3)

K6197204 1.0 ug DNA
EUR 154

MSC sgRNA CRISPR Lentivector (Human) (Target 1)

K1348002 1.0 ug DNA
EUR 154

MSC sgRNA CRISPR Lentivector (Human) (Target 2)

K1348003 1.0 ug DNA
EUR 154

MSC sgRNA CRISPR Lentivector (Human) (Target 3)

K1348004 1.0 ug DNA
EUR 154

MSC Protein Vector (Rat) (pPB-C-His)

PV283378 500 ng
EUR 603

MSC Protein Vector (Rat) (pPB-N-His)

PV283379 500 ng
EUR 603

MSC Protein Vector (Rat) (pPM-C-HA)

PV283380 500 ng
EUR 603

MSC Protein Vector (Rat) (pPM-C-His)

PV283381 500 ng
EUR 603

MSC Protein Vector (Human) (pPB-C-His)

PV026861 500 ng
EUR 329

MSC Protein Vector (Human) (pPB-N-His)

PV026862 500 ng
EUR 329

MSC Protein Vector (Human) (pPM-C-HA)

PV026863 500 ng
EUR 329

MSC Protein Vector (Human) (pPM-C-His)

PV026864 500 ng
EUR 329

MSC Protein Vector (Mouse) (pPB-C-His)

PV202382 500 ng
EUR 603

MSC Protein Vector (Mouse) (pPB-N-His)

PV202383 500 ng
EUR 603

MSC Protein Vector (Mouse) (pPM-C-HA)

PV202384 500 ng
EUR 603

MSC Protein Vector (Mouse) (pPM-C-His)

PV202385 500 ng
EUR 603

StemTAG Stem Cell Colony Formation Assay (Cell Recovery Compatible)

CBA-325 96 assays
EUR 856
Description: Our StemTAG 96-Well Stem Cell Colony Formation Assay provides a high-throughput method to quantify ES cells in just 7-10 days, and no manual cell counting is required. Once colonies are formed, they may be analyzed in three different ways: 1. Lyse cells, then quantify in a fluorescence plate reader using dye included in the kit; 2. Lyse cells, then quantify alkaline phosphatase activity using reagents provided; or 3. Recover colonies from matrix for further culture or analysis.

StemTAG Stem Cell Colony Formation Assay (Cell Recovery Compatible)

CBA-325-5 5 x 96 assays
EUR 3361
Description: Our StemTAG 96-Well Stem Cell Colony Formation Assay provides a high-throughput method to quantify ES cells in just 7-10 days, and no manual cell counting is required. Once colonies are formed, they may be analyzed in three different ways: 1. Lyse cells, then quantify in a fluorescence plate reader using dye included in the kit; 2. Lyse cells, then quantify alkaline phosphatase activity using reagents provided; or 3. Recover colonies from matrix for further culture or analysis.

CytoSelect Cell Transformation Assay (Cell Recovery Compatible), Colorimetric, Trial Size

CBA-135-T 24 assays
EUR 432
Description: CytoSelect 96-Well Cell Transformation Assays (Cell Recovery Compatible) provide a robust system for detecting transformed cells, screening cell transformation inhibitors, and determining in vitro drug sensitivity. A proprietary modified soft agar matrix allows you to either quantify cells using the included fluorescent dye, or recover the cells for further analysis.

293/GFP Cell Line

AKR-200 1 vial
EUR 572
Description: 293/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

T47D/GFP Cell Line

AKR-208 1 vial
EUR 572
Description: T47D/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

A549/GFP Cell Line

AKR-209 1 vial
EUR 572
Description: A549/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

HeLa/GFP Cell Line

AKR-213 1 vial
EUR 572
Description: HeLa/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

NIH3T3/GFP Cell Line

AKR-214 1 vial
EUR 572
Description: NIH3T3/GFP Cell Line stably expresses GFP and otherwise exhibits the same characteristics of the parental cell line.

NIH3T3/Cas9 Cell Line

AKR-5104 1 vial
EUR 572

293/Cas9 Cell Line

AKR-5110 1 vial
EUR 572

HeLa/Cas9 Cell Line

AKR-5111 1 vial
EUR 572

CytoSelect 96-Well Cell Transformation Assay (Cell Recovery Compatible, Fluorometric), Trial Size

CBA-140-T 24 assays
EUR 456
Description: CytoSelect 96-Well Cell Transformation Assays (Cell Recovery Compatible) provide a robust system for detecting transformed cells, screening cell transformation inhibitors, and determining in vitro drug sensitivity. A proprietary modified soft agar matrix allows you to either quantify cells using the included fluorescent dye, or recover the cells for further analysis.

SKOV-3/Luc Cell Line

AKR-232 1 vial
EUR 572
Description: SKOV-3/Luc Cell Line stably expresses luciferase and otherwise exhibits the same characteristics of the parental cell line.

MCF-7/Luc Cell Line

AKR-234 1 vial
EUR 572
Description: MCF-7/Luc Cell Line stably expresses luciferase and otherwise exhibits the same characteristics of the parental cell line.

OVCAR-5/RFP Cell Line

AKR-254 1 vial
EUR 572
Description: OVCAR-5/RFP Cell Line stably expresses RFP and otherwise exhibits the same characteristics of the parental cell line.

Collagen-based Cell Contraction Assay

CBA-201 24 assays
EUR 485
Description: Cell Biolabs? Collagen-based Contraction Assay Kit provides a simple system to assess cell contractivity in vitro and screen cell contraction mediators. Each kit provides sufficient quantities to perform up to 24 assays in a 24-well plate. The kit can be also used in culturing cells in 3D collagen matrix.

CytoSelect MTT Cell Proliferation Assay

CBA-252 960 assays
EUR 409
Description: Cell Biolabs? CytoSelect MTT Cell Proliferation Assay provides a colorimetric format for measuring and monitoring cell proliferation.  The kit contains sufficient reagents for the evaluation of 960 assays in 96-well plates or 192 assays in 24-well plates.  Cells can be plated and then treated with compounds or agents that affect proliferation.  Cells are then detected with the proliferation reagent, which is converted in live cells from the yellow tetrazole MTT to the purple formazan form by a cellular reductase (Figure 1).  An increase in cell proliferation is accompanied by an increased signal, while a decrease in cell proliferation (and signal) can indicate the toxic effects of compounds or suboptimal culture conditions.  The assay principles are basic and can be applied to most eukaryotic cell lines, including adherent and non-adherent cells and certain tissues.  This cell proliferation reagent can be used to detect proliferation in bacteria, yeast, fungi, protozoa as well as cultured mammalian and piscine cells.

CytoSelect 24-well Cell Invasion, Fluorometric

CBA-111 12 assays
EUR 595
Description: The ability of malignant tumor cells to invade normal surrounding tissue contributes in large part to the morbidity and mortality of cancers. Cell invasion requires several distinct cellular functions including adhesion, motility, detachment, and extracellular matrix proteolysis. Our CytoSelect Cell Invasion Assays utilize precoated inserts to assay the invasive properties of tumor cells. Invasive cells can be quantified in 24-well plates on either a standard microplate reader or a fluorescence plate reader. Inserts are precoated on the top of the membrane with ECM matrix gel (basement membrane), a protein mix isolated from EHS tumor cells.