GALNT13

GALNT13 siRNA

20-abx902081
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GALNT13 siRNA

20-abx917524
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GALNT13 siRNA

20-abx917525
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-GALNT13

YF-PA21885 50 ug
EUR 363
Description: Mouse polyclonal to GALNT13

GALNT13 Blocking Peptide

33R-1754 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GALNT13 antibody, catalog no. 70R-7449

GALNT13 cloning plasmid

CSB-CL816873HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1686
  • Sequence: ATGAGGAGATTTGTCTACTGCAAGGTGGTTCTAGCCACTTCGCTGATGTGGGTTCTTGTTGATGTCTTCTTACTGCTGTACTTCAGTGAATGTAACAAATGTGATGACAAGAAGGAGAGATCTCTGCTGCCTGCATTGAGGGCTGTTATTTCAAGAAACCAAGAAGGGCCAGGAG
  • Show more
Description: A cloning plasmid for the GALNT13 gene.

Anti-GALNT13 (3F3)

YF-MA19744 100 ug
EUR 363
Description: Mouse monoclonal to GALNT13

Rat GALNT13 shRNA Plasmid

20-abx989647
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human GALNT13 shRNA Plasmid

20-abx964387
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GALNT13 shRNA Plasmid

20-abx983132
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GALNT13 Recombinant Protein (Human)

RP039385 100 ug Ask for price

GALNT13 Recombinant Protein (Rat)

RP202163 100 ug Ask for price

GALNT13 Recombinant Protein (Mouse)

RP135824 100 ug Ask for price

Galnt13 ORF Vector (Rat) (pORF)

ORF067389 1.0 ug DNA
EUR 506

GALNT13 ORF Vector (Human) (pORF)

ORF013129 1.0 ug DNA
EUR 354

Galnt13 ORF Vector (Mouse) (pORF)

ORF045276 1.0 ug DNA
EUR 506

GALNT13 ELISA Kit (Human) (OKCA01432)

OKCA01432 96 Wells
EUR 846
Description: Description of target: Catalyzes the initial reaction in O-linked oligosaccharide biosynthesis, the transfer of an N-acetyl-D-galactosamine residue to a serine or threonine residue on the protein receptor. Has a much stronger activity than GALNT1 to transfer GalNAc to mucin peptides, such as Muc5Ac and Muc7. Able to glycosylate SDC3. May be responsible for the synthesis of Tn antigen in neuronal cells. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 9.77 pg/mL

Polypeptide N-Acetylgalactosaminyltransferase 13 (GALNT13) Antibody

abx030102-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Polypeptide N-Acetylgalactosaminyltransferase 13 (GALNT13) Antibody

abx030102-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Human Polypeptide N- acetylgalactosaminyltransferase 13, GALNT13

ELI-27993h 96 Tests
EUR 824

Mouse Polypeptide N- acetylgalactosaminyltransferase 13, Galnt13

ELI-27303m 96 Tests
EUR 865

Galnt13 sgRNA CRISPR Lentivector set (Rat)

K7420001 3 x 1.0 ug
EUR 339

Galnt13 sgRNA CRISPR Lentivector set (Mouse)

K3614501 3 x 1.0 ug
EUR 339

GALNT13 sgRNA CRISPR Lentivector set (Human)

K0836301 3 x 1.0 ug
EUR 339

Rat Polypeptide N- acetylgalactosaminyltransferase 13, Galnt13 E

ELI-08216r 96 Tests
EUR 886

Galnt13 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7420002 1.0 ug DNA
EUR 154

Galnt13 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7420003 1.0 ug DNA
EUR 154

Galnt13 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7420004 1.0 ug DNA
EUR 154

Galnt13 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3614502 1.0 ug DNA
EUR 154

Galnt13 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3614503 1.0 ug DNA
EUR 154

Galnt13 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3614504 1.0 ug DNA
EUR 154

GALNT13 sgRNA CRISPR Lentivector (Human) (Target 1)

K0836302 1.0 ug DNA
EUR 154

GALNT13 sgRNA CRISPR Lentivector (Human) (Target 2)

K0836303 1.0 ug DNA
EUR 154

GALNT13 sgRNA CRISPR Lentivector (Human) (Target 3)

K0836304 1.0 ug DNA
EUR 154

GALNT13 Protein Vector (Rat) (pPB-C-His)

PV269554 500 ng
EUR 603

GALNT13 Protein Vector (Rat) (pPB-N-His)

PV269555 500 ng
EUR 603

GALNT13 Protein Vector (Rat) (pPM-C-HA)

PV269556 500 ng
EUR 603

GALNT13 Protein Vector (Rat) (pPM-C-His)

PV269557 500 ng
EUR 603

GALNT13 Protein Vector (Mouse) (pPB-C-His)

PV181102 500 ng
EUR 603

GALNT13 Protein Vector (Mouse) (pPB-N-His)

PV181103 500 ng
EUR 603

GALNT13 Protein Vector (Mouse) (pPM-C-HA)

PV181104 500 ng
EUR 603

GALNT13 Protein Vector (Mouse) (pPM-C-His)

PV181105 500 ng
EUR 603

GALNT13 Protein Vector (Human) (pPB-C-His)

PV052513 500 ng
EUR 481

GALNT13 Protein Vector (Human) (pPB-N-His)

PV052514 500 ng
EUR 481

GALNT13 Protein Vector (Human) (pPM-C-HA)

PV052515 500 ng
EUR 481

GALNT13 Protein Vector (Human) (pPM-C-His)

PV052516 500 ng
EUR 481

Galnt13 3'UTR Luciferase Stable Cell Line

TU106883 1.0 ml Ask for price

Galnt13 3'UTR GFP Stable Cell Line

TU156883 1.0 ml Ask for price

Galnt13 3'UTR Luciferase Stable Cell Line

TU204926 1.0 ml Ask for price

Galnt13 3'UTR GFP Stable Cell Line

TU254926 1.0 ml Ask for price

GALNT13 3'UTR GFP Stable Cell Line

TU058532 1.0 ml
EUR 2333

GALNT13 3'UTR Luciferase Stable Cell Line

TU008532 1.0 ml
EUR 2333

GALNT13 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV663823 1.0 ug DNA
EUR 682

GALNT13 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV663827 1.0 ug DNA
EUR 682

GALNT13 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV663828 1.0 ug DNA
EUR 682

Galnt13 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7420005 3 x 1.0 ug
EUR 376

Galnt13 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3614505 3 x 1.0 ug
EUR 376

GALNT13 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0836305 3 x 1.0 ug
EUR 376

Galnt13 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7420006 1.0 ug DNA
EUR 167

Galnt13 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7420007 1.0 ug DNA
EUR 167

Galnt13 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7420008 1.0 ug DNA
EUR 167

GALNT13 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV663824 1.0 ug DNA
EUR 682

GALNT13 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV663825 1.0 ug DNA
EUR 740

GALNT13 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV663826 1.0 ug DNA
EUR 740

Galnt13 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3614506 1.0 ug DNA
EUR 167

Galnt13 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3614507 1.0 ug DNA
EUR 167

Galnt13 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3614508 1.0 ug DNA
EUR 167

GALNT13 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0836306 1.0 ug DNA
EUR 167

GALNT13 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0836307 1.0 ug DNA
EUR 167

GALNT13 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0836308 1.0 ug DNA
EUR 167