EIF3M antibody

70R-1252 100 ug
EUR 377
Description: Rabbit polyclonal EIF3M antibody raised against the N terminal of EIF3M

EIF3M Antibody

40052-100ul 100ul
EUR 390

EIF3M Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EIF3M. Recognizes EIF3M from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IP:1:200-1:2000

EIF3M Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF3M. Recognizes EIF3M from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

EIF3M Antibody

DF12602 200ul
EUR 304
Description: EIF3M Antibody detects endogenous levels of EIF3M.

EIF3M Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EIF3M. Recognizes EIF3M from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF3M Polyclonal Antibody

30564-100ul 100ul
EUR 252

EIF3M Polyclonal Antibody

30564-50ul 50ul
EUR 187

EIF3M Blocking Peptide

33R-6523 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EIF3M antibody, catalog no. 70R-1252

EIF3M Blocking Peptide

DF12602-BP 1mg
EUR 195

Human EIF3M Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

EIF3M cloning plasmid

CSB-CL745333HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1125
  • Sequence: atgagcgtcccggccttcatcgacatcagtgaagaagatcaggctgctgagcttcgtgcttatctgaaatctaaaggagctgagatttcagaagagaactcggaaggtggacttcatgttgatttagctcaaattattgaagcctgtgatgtgtgtctgaaggaggatgataaag
  • Show more
Description: A cloning plasmid for the EIF3M gene.

EIF3M Rabbit pAb

A4426-100ul 100 ul
EUR 308

EIF3M Rabbit pAb

A4426-200ul 200 ul
EUR 459

EIF3M Rabbit pAb

A4426-20ul 20 ul
EUR 183

EIF3M Rabbit pAb

A4426-50ul 50 ul
EUR 223

anti- EIF3M antibody

FNab02714 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: eukaryotic translation initiation factor 3, subunit M
  • Uniprot ID: Q7L2H7
  • Gene ID: 10480
  • Research Area: Metabolism
Description: Antibody raised against EIF3M

anti- EIF3M antibody

FNab02715 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:2000
  • IF: 1:10-1:100
  • Immunogen: eukaryotic translation initiation factor 3, subunit M
  • Uniprot ID: Q7L2H7
  • Gene ID: 10480
  • Research Area: Metabolism
Description: Antibody raised against EIF3M

Anti-EIF3M antibody

PAab02714 100 ug
EUR 355

Anti-EIF3M antibody

STJ23513 100 µl
EUR 277
Description: This gene encodes a protein that is part of the eurkaryotic translation initiation factor 3 complete (eIF-3) required for protein synthesis. Elevated levels of the encoded protein are present in cancer cell lines. Inactivation of the encoded protein has been shown to interfere with translation of herpes virus mRNAs by preventing the association of mRNAs with the ribosomes. A pseudogene of this gene is located on the X chromosome.

EIF3M Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF3M. Recognizes EIF3M from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EIF3M Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF3M. Recognizes EIF3M from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EIF3M Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EIF3M. Recognizes EIF3M from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA


ELI-26105h 96 Tests
EUR 824


ELI-26584c 96 Tests
EUR 928

Mouse Eif3m ELISA KIT

ELI-26899m 96 Tests
EUR 865


EF009348 96 Tests
EUR 689

EIF3M Polyclonal Conjugated Antibody

C30564 100ul
EUR 397

Human EIF3M shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse EIF3M shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-48146b 96 Tests
EUR 928

EIF3M Recombinant Protein (Human)

RP010432 100 ug Ask for price

EIF3M Recombinant Protein (Rat)

RP199373 100 ug Ask for price

EIF3M Recombinant Protein (Mouse)

RP131303 100 ug Ask for price

Eif3m ORF Vector (Rat) (pORF)

ORF066459 1.0 ug DNA
EUR 506

EIF3M ORF Vector (Human) (pORF)

ORF003478 1.0 ug DNA
EUR 95

Eif3m ORF Vector (Mouse) (pORF)

ORF043769 1.0 ug DNA
EUR 506

Polyclonal EIF3M / PCID1 Antibody (C-Terminus)

APR11073G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human EIF3M / PCID1 (C-Terminus). This antibody is tested and proven to work in the following applications:

EIF3M sgRNA CRISPR Lentivector set (Human)

K0668901 3 x 1.0 ug
EUR 339

Eif3m sgRNA CRISPR Lentivector set (Rat)

K6239701 3 x 1.0 ug
EUR 339

Eif3m sgRNA CRISPR Lentivector set (Mouse)

K4087301 3 x 1.0 ug
EUR 339

Anti-B5 Receptor / PCID1 / EIF3M antibody

STJ70788 100 µg
EUR 359

EIF3M sgRNA CRISPR Lentivector (Human) (Target 1)

K0668902 1.0 ug DNA
EUR 154

EIF3M sgRNA CRISPR Lentivector (Human) (Target 2)

K0668903 1.0 ug DNA
EUR 154

EIF3M sgRNA CRISPR Lentivector (Human) (Target 3)

K0668904 1.0 ug DNA
EUR 154

Eif3m sgRNA CRISPR Lentivector (Rat) (Target 1)

K6239702 1.0 ug DNA
EUR 154

Eif3m sgRNA CRISPR Lentivector (Rat) (Target 2)

K6239703 1.0 ug DNA
EUR 154

Eif3m sgRNA CRISPR Lentivector (Rat) (Target 3)

K6239704 1.0 ug DNA
EUR 154

Eif3m sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4087302 1.0 ug DNA
EUR 154

Eif3m sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4087303 1.0 ug DNA
EUR 154

Eif3m sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4087304 1.0 ug DNA
EUR 154

EIF3M Protein Vector (Mouse) (pPB-C-His)

PV175074 500 ng
EUR 603

EIF3M Protein Vector (Mouse) (pPB-N-His)

PV175075 500 ng
EUR 603

EIF3M Protein Vector (Mouse) (pPM-C-HA)

PV175076 500 ng
EUR 603

EIF3M Protein Vector (Mouse) (pPM-C-His)

PV175077 500 ng
EUR 603

EIF3M Protein Vector (Rat) (pPB-C-His)

PV265834 500 ng
EUR 603

EIF3M Protein Vector (Rat) (pPB-N-His)

PV265835 500 ng
EUR 603

EIF3M Protein Vector (Rat) (pPM-C-HA)

PV265836 500 ng
EUR 603

EIF3M Protein Vector (Rat) (pPM-C-His)

PV265837 500 ng
EUR 603

EIF3M Protein Vector (Human) (pPB-C-His)

PV013909 500 ng
EUR 329

EIF3M Protein Vector (Human) (pPB-N-His)

PV013910 500 ng
EUR 329

EIF3M Protein Vector (Human) (pPM-C-HA)

PV013911 500 ng
EUR 329

EIF3M Protein Vector (Human) (pPM-C-His)

PV013912 500 ng
EUR 329

Recombinant Eukaryotic Translation Initiation Factor 3M (EIF3M)

  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q7L2H7
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.7kDa
  • Isoelectric Point: 5
Description: Recombinant Human Eukaryotic Translation Initiation Factor 3M expressed in: E.coli

Eif3m 3'UTR GFP Stable Cell Line

TU155725 1.0 ml Ask for price

Eif3m 3'UTR Luciferase Stable Cell Line

TU105725 1.0 ml Ask for price

Eif3m 3'UTR Luciferase Stable Cell Line

TU203891 1.0 ml Ask for price

Eif3m 3'UTR GFP Stable Cell Line

TU253891 1.0 ml Ask for price