EEF1D antibody

70R-17002 50 ul
EUR 435
Description: Rabbit polyclonal EEF1D antibody

EEF1D antibody

38412-100ul 100ul
EUR 252

EEF1D Antibody

DF6974 200ul
EUR 304
Description: EEF1D Antibody detects endogenous levels of total EEF1D.

EEF1D Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EEF1D. Recognizes EEF1D from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

EEF1D Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF1D. Recognizes EEF1D from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EEF1D Antibody

ABD6974 100 ug
EUR 438


YF-PA11496 50 ug
EUR 363
Description: Mouse polyclonal to EEF1D


YF-PA11497 100 ug
EUR 403
Description: Rabbit polyclonal to EEF1D


YF-PA23623 50 ul
EUR 334
Description: Mouse polyclonal to EEF1D

EEF1D Blocking Peptide

DF6974-BP 1mg
EUR 195

Polyclonal EEF1D Antibody

AMM07014G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EEF1D . This antibody is tested and proven to work in the following applications:

EEF1D Conjugated Antibody

C38412 100ul
EUR 397

EEF1D cloning plasmid

CSB-CL007431HU1-10ug 10ug
EUR 654
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1944
  • Sequence: atgaggagcgggaaggcctcctgcaccctggagaccgtgtgggaagacaagcacaagtatgaggaggccgagcggcgcttctacgaacacgaggccacacaggcggccgcctccgcccagcagctgccagccgaggggccagccatgaatgggcccggccaggacgaccctgagg
  • Show more
Description: A cloning plasmid for the EEF1D gene.

EEF1D cloning plasmid

CSB-CL007431HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 846
  • Sequence: atggctacaaacttcctagcacatgagaagatctggttcgacaagttcaaatatgacgacgcagaaaggagattctacgagcagatgaacgggcctgtggcaggtgcctcccgccaggagaacggcgccagcgtgatcctccgtgacattgcgagagccagagagaacatccagaa
  • Show more
Description: A cloning plasmid for the EEF1D gene.

EEF1D Polyclonal Antibody

A54224 100 µg
EUR 570.55
Description: Ask the seller for details

EEF1D Rabbit pAb

A2509-100ul 100 ul
EUR 308

EEF1D Rabbit pAb

A2509-200ul 200 ul
EUR 459

EEF1D Rabbit pAb

A2509-20ul 20 ul
EUR 183

EEF1D Rabbit pAb

A2509-50ul 50 ul
EUR 223

anti- EEF1D antibody

FNab02646 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)
  • Uniprot ID: P29692
  • Gene ID: 1936
  • Research Area: Signal Transduction, Metab
  • Show more
Description: Antibody raised against EEF1D

anti- EEF1D antibody

FNab02647 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:2000
  • IF: 1:10-1:100
  • IHC: 1:50-1:500
  • Immunogen: eukaryotic translation elongation factor 1 delta(guanine nucleotide exchange protein)
  • Uniprot ID: P29692
  • Gene ID: 1936
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against EEF1D

anti- EEF1D antibody

FNab02648 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: eukaryotic translation elongation factor 1 delta(guanine nucleotide exchange protein)
  • Uniprot ID: P29692
  • Gene ID: 1936
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against EEF1D

Anti-EEF1D antibody

PAab02646 100 ug
EUR 355

Anti-EEF1D antibody

STJ23477 100 µl
EUR 277
Description: This gene encodes a subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This subunit, delta, functions as guanine nucleotide exchange factor. It is reported that following HIV-1 infection, this subunit interacts with HIV-1 Tat. This interaction results in repression of translation of host cell proteins and enhanced translation of viral proteins. Several alternatively spliced transcript variants encoding multiple isoforms have been found for this gene. Related pseudogenes have been defined on chromosomes 1, 6, 7, 9, 11, 13, 17, 19.

Anti-EEF1D (4B12)

YF-MA10264 100 ug
EUR 363
Description: Mouse monoclonal to EEF1D

EEF1D protein (His tag)

80R-1713 50 ug
EUR 397
Description: Purified recombinant Human EEF1D protein


EF009298 96 Tests
EUR 689

Rat EEF1D shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse EEF1D shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EEF1D Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF1D. Recognizes EEF1D from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EEF1D Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF1D. Recognizes EEF1D from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EEF1D Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EEF1D. Recognizes EEF1D from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human EEF1D shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EEF1D Recombinant Protein (Human)

RP010204 100 ug Ask for price

EEF1D Recombinant Protein (Human)

RP010207 100 ug Ask for price

EEF1D Recombinant Protein (Rat)

RP199088 100 ug Ask for price

EEF1D Recombinant Protein (Mouse)

RP130904 100 ug Ask for price

EEF1D Recombinant Protein (Mouse)

RP130907 100 ug Ask for price

Polyclonal EEF1D Antibody (N-term)

AMM07016G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EEF1D (N-term). This antibody is tested and proven to work in the following applications:

EEF1D Polyclonal Antibody, Biotin Conjugated

A54221 100 µg
EUR 570.55
Description: reagents widely cited

EEF1D Polyclonal Antibody, FITC Conjugated

A54222 100 µg
EUR 570.55
Description: Ask the seller for details

EEF1D Polyclonal Antibody, HRP Conjugated

A54223 100 µg
EUR 570.55
Description: The best epigenetics products

Eef1d ORF Vector (Rat) (pORF)

ORF066364 1.0 ug DNA
EUR 506

EEF1D ORF Vector (Human) (pORF)

ORF003402 1.0 ug DNA
EUR 95

EEF1D ORF Vector (Human) (pORF)

ORF003403 1.0 ug DNA
EUR 95

Eef1d ORF Vector (Mouse) (pORF)

ORF043636 1.0 ug DNA
EUR 506

Eef1d ORF Vector (Mouse) (pORF)

ORF043637 1.0 ug DNA
EUR 506

Human Elongation factor 1-delta (EEF1D)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 35 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Elongation factor 1-delta(EEF1D) expressed in E.coli

EEF1D sgRNA CRISPR Lentivector set (Human)

K0657001 3 x 1.0 ug
EUR 339

Eef1d sgRNA CRISPR Lentivector set (Rat)

K7151201 3 x 1.0 ug
EUR 339

Eef1d sgRNA CRISPR Lentivector set (Mouse)

K4608201 3 x 1.0 ug
EUR 339

Monoclonal EEF1D Antibody (monoclonal) (M04), Clone: 4B12

AMM07015G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human EEF1D (monoclonal) (M04). The antibodies are raised in mouse and are from clone 4B12. This antibody is applicable in WB and IF, E

EEF1D sgRNA CRISPR Lentivector (Human) (Target 1)

K0657002 1.0 ug DNA
EUR 154

EEF1D sgRNA CRISPR Lentivector (Human) (Target 2)

K0657003 1.0 ug DNA
EUR 154

EEF1D sgRNA CRISPR Lentivector (Human) (Target 3)

K0657004 1.0 ug DNA
EUR 154

Eef1d sgRNA CRISPR Lentivector (Rat) (Target 1)

K7151202 1.0 ug DNA
EUR 154

Eef1d sgRNA CRISPR Lentivector (Rat) (Target 2)

K7151203 1.0 ug DNA
EUR 154

Eef1d sgRNA CRISPR Lentivector (Rat) (Target 3)

K7151204 1.0 ug DNA
EUR 154

Eef1d sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4608202 1.0 ug DNA
EUR 154

Eef1d sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4608203 1.0 ug DNA
EUR 154

Eef1d sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4608204 1.0 ug DNA
EUR 154

EEF1D Protein Vector (Mouse) (pPB-C-His)

PV174542 500 ng
EUR 603

EEF1D Protein Vector (Mouse) (pPB-N-His)

PV174543 500 ng
EUR 603

EEF1D Protein Vector (Mouse) (pPM-C-HA)

PV174544 500 ng
EUR 603

EEF1D Protein Vector (Mouse) (pPM-C-His)

PV174545 500 ng
EUR 603

EEF1D Protein Vector (Mouse) (pPB-C-His)

PV174546 500 ng
EUR 603

EEF1D Protein Vector (Mouse) (pPB-N-His)

PV174547 500 ng
EUR 603