CTSA

Human Cathepsin A (CTSA) ELISA Kit

DLR-CTSA-Hu-96T 96T
EUR 621
  • Should the Human Cathepsin A (CTSA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Cathepsin A (CTSA) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Cathepsin A (CTSA) ELISA Kit

DLR-CTSA-Mu-48T 48T
EUR 489
  • Should the Mouse Cathepsin A (CTSA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Cathepsin A (CTSA) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Mouse Cathepsin A (CTSA) ELISA Kit

DLR-CTSA-Mu-96T 96T
EUR 635
  • Should the Mouse Cathepsin A (CTSA) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Cathepsin A (CTSA) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Cathepsin A (CTSA) ELISA Kit

RDR-CTSA-Hu-48Tests 48 Tests
EUR 500

Human Cathepsin A (CTSA) ELISA Kit

RDR-CTSA-Hu-96Tests 96 Tests
EUR 692

Mouse Cathepsin A (CTSA) ELISA Kit

RDR-CTSA-Mu-48Tests 48 Tests
EUR 511

Mouse Cathepsin A (CTSA) ELISA Kit

RDR-CTSA-Mu-96Tests 96 Tests
EUR 709

Human Cathepsin A (CTSA) ELISA Kit

RD-CTSA-Hu-48Tests 48 Tests
EUR 478

Human Cathepsin A (CTSA) ELISA Kit

RD-CTSA-Hu-96Tests 96 Tests
EUR 662

Mouse Cathepsin A (CTSA) ELISA Kit

RD-CTSA-Mu-48Tests 48 Tests
EUR 489

Mouse Cathepsin A (CTSA) ELISA Kit

RD-CTSA-Mu-96Tests 96 Tests
EUR 677

CTSA antibody

70R-16658 50 ul
EUR 435
Description: Rabbit polyclonal CTSA antibody

CTSA Antibody

32893-100ul 100ul
EUR 252

CTSA Antibody

42724-100ul 100ul
EUR 252

CTSA Antibody

1-CSB-PA006184GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CTSA. Recognizes CTSA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CTSA Antibody

1-CSB-PA006184LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CTSA. Recognizes CTSA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

CTSA Antibody

1-CSB-PA126140
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CTSA. Recognizes CTSA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

CTSA Antibody

DF7381 200ul
EUR 304
Description: CTSA Antibody detects endogenous levels of total CTSA.

CTSA siRNA

20-abx913132
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CTSA siRNA

20-abx913133
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CTSA Antibody

ABD7381 100 ug
EUR 438

pOTB7-CTSA

PVT18717 2 ug
EUR 231

anti-CTSA

YF-PA27329 50 ug
EUR 363
Description: Mouse polyclonal to CTSA

CTSA Rabbit pAb

A10884-100ul 100 ul
EUR 308

CTSA Rabbit pAb

A10884-200ul 200 ul
EUR 459

CTSA Rabbit pAb

A10884-20ul 20 ul Ask for price

CTSA Rabbit pAb

A10884-50ul 50 ul Ask for price

CTSA Blocking Peptide

DF7381-BP 1mg
EUR 195

CTSA Conjugated Antibody

C42724 100ul
EUR 397

CTSA Conjugated Antibody

C32893 100ul
EUR 397

CTSA cloning plasmid

CSB-CL006184HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1440
  • Sequence: atgatccgagccgcgccgccgccgctgttcctgctgctgctgctgctgctgctagtgtcctgggcgtcccgaggcgaggcagcccccgaccaggacgagatccagcgcctccccgggctggccaagcagccgtctttccgccagtactccggctacctcaaaggctccggctcca
  • Show more
Description: A cloning plasmid for the CTSA gene.

CTSA Polyclonal Antibody

A62350 100 µg
EUR 570.55
Description: Ask the seller for details

CTSA Rabbit pAb

A5503-100ul 100 ul
EUR 308

CTSA Rabbit pAb

A5503-200ul 200 ul
EUR 459

CTSA Rabbit pAb

A5503-20ul 20 ul
EUR 183

CTSA Rabbit pAb

A5503-50ul 50 ul
EUR 223

Anti-CTSA antibody

STJ27454 100 µl
EUR 277
Description: This gene encodes a member of the peptidase S10 family of serine carboxypeptidases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate two chains that comprise the heterodimeric active enzyme. This enzyme possesses deamidase, esterase and carboxypeptidase activities and acts as a scaffold in the lysosomal multienzyme complex. Mutations in this gene are associated with galactosialidosis.

Anti-CTSA antibody

STJ112780 100 µl
EUR 277
Description: This gene encodes a member of the peptidase S10 family of serine carboxypeptidases. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate two chains that comprise the heterodimeric active enzyme. This enzyme possesses deamidase, esterase and carboxypeptidase activities and acts as a scaffold in the lysosomal multienzyme complex. Mutations in this gene are associated with galactosialidosis.

CTSA Antibody, HRP conjugated

1-CSB-PA006184LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CTSA. Recognizes CTSA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CTSA Antibody, FITC conjugated

1-CSB-PA006184LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CTSA. Recognizes CTSA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CTSA Antibody, Biotin conjugated

1-CSB-PA006184LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CTSA. Recognizes CTSA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Cleaved-CTSA (R326) Antibody

1-CSB-PA000028
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Cleaved-CTSA (R326). Recognizes Cleaved-CTSA (R326) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

Cathepsin A (CTSA) Antibody

abx025734-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Cathepsin A (CTSA) Antibody

abx025734-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Cathepsin A (CTSA) Antibody

20-abx004218
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cathepsin A (CTSA) Antibody

20-abx175728
  • EUR 1135.00
  • EUR 551.00
  • 1 mg
  • 200 ug
  • Please enquire.

Cathepsin A (CTSA) Antibody

20-abx211985
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cathepsin A (CTSA) Antibody

20-abx100743
  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Cathepsin A (CTSA) Antibody

20-abx100744
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Cathepsin A (CTSA) Antibody

20-abx100745
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cathepsin A (CTSA) Antibody

20-abx100746
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Cathepsin A (CTSA) Antibody

20-abx100747
  • EUR 453.00
  • EUR 133.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Cathepsin A (CTSA) Antibody

20-abx104869
  • EUR 453.00
  • EUR 133.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Cathepsin A (CTSA) Antibody

20-abx111441
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Cathepsin A (CTSA) Antibody

20-abx126877
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Cathepsin A (CTSA) Antibody

abx122591-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Cathepsin A (CTSA) Antibody

20-abx171626
  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.

Human CTSA ELISA Kit

ELA-E1620h 96 Tests
EUR 824

CTSA ELISA KIT|Human

EF004082 96 Tests
EUR 689

Mouse CTSA shRNA Plasmid

20-abx972159
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Cathepsin A (CTSA) Antibody

20-abx325414
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cathepsin A (CTSA) Antibody

20-abx301924
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cathepsin A (CTSA) Antibody

abx231303-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Human CTSA shRNA Plasmid

20-abx953674
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Recombinant Cathepsin A (CTSA)

4-RPA348Bo01
  • EUR 537.25
  • EUR 247.00
  • EUR 1739.68
  • EUR 646.56
  • EUR 1193.12
  • EUR 422.00
  • EUR 4199.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q3MI05
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.8KDa
  • Isoelectric Point: Inquire
Description: Recombinant Bovine Cathepsin A expressed in: E.coli

Recombinant Cathepsin A (CTSA)

4-RPA348Ca01
  • EUR 583.84
  • EUR 259.00
  • EUR 1914.40
  • EUR 704.80
  • EUR 1309.60
  • EUR 454.00
  • EUR 4636.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: F1P9I9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 62.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Dog Cathepsin A expressed in: E.coli

Recombinant Cathepsin A (CTSA)

4-RPA348Hu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P10619
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 61.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Cathepsin A expressed in: E.coli

Recombinant Cathepsin A (CTSA)

4-RPA348Mu01
  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P10619
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 61.4kDa
  • Isoelectric Point: 6.8
Description: Recombinant Mouse Cathepsin A expressed in: E.coli

Recombinant Cathepsin A (CTSA)

4-RPA348Po01
  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • EUR 660.00
  • EUR 1220.00
  • EUR 430.00
  • EUR 4300.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: F1SC70
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 60.3kDa
  • Isoelectric Point: 6.6
Description: Recombinant Pig Cathepsin A expressed in: E.coli

Recombinant Cathepsin A (CTSA)

4-RPA348Ra01
  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q6AYS3
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 59.8kDa
  • Isoelectric Point: 6.5
Description: Recombinant Rat Cathepsin A expressed in: E.coli