COX17

COX17 Antibody

ABF0626 100 ug
EUR 438

COX17 siRNA

20-abx912587
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

COX17 siRNA

20-abx912588
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

COX17 antibody

70R-50771 100 ul
EUR 244
Description: Purified Polyclonal COX17 antibody

COX17 antibody

70R-32389 100 ug
EUR 327
Description: Rabbit polyclonal COX17 antibody

COX17 Antibody

ABD3558 100 ug
EUR 438

COX17 Antibody

34220-100ul 100ul
EUR 252

COX17 Antibody

34220-50ul 50ul
EUR 187

COX17 Antibody

43251-100ul 100ul
EUR 252

COX17 antibody

70R-16533 50 ul
EUR 435
Description: Rabbit polyclonal COX17 antibody

COX17 Antibody

DF3558 200ul
EUR 304
Description: COX17 Antibody detects endogenous levels of total COX17.

COX17 Antibody

1-CSB-PA001762
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against COX17. Recognizes COX17 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

COX17 Antibody

1-CSB-PA005829GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against COX17. Recognizes COX17 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

COX17 Antibody

1-CSB-PA619858LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against COX17. Recognizes COX17 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

COX17 Antibody

CSB-PA146897-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against COX17. Recognizes COX17 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

COX17 Antibody

CSB-PA146897-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against COX17. Recognizes COX17 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

anti-COX17

YF-PA25473 50 ul
EUR 334
Description: Mouse polyclonal to COX17

COX17, Cytochrome C Oxidase Copper Chaperone (COX17) Antibody

20-abx111812
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

COX17, Cytochrome C Oxidase Copper Chaperone (COX17) Antibody

20-abx008363
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

COX17, Cytochrome C Oxidase Copper Chaperone (COX17) Antibody

20-abx013967
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

COX17, Cytochrome C Oxidase Copper Chaperone (COX17) Antibody

20-abx306974
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

COX17, Cytochrome C Oxidase Copper Chaperone (COX17) Antibody

20-abx329667
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

COX17, Cytochrome C Oxidase Copper Chaperone (COX17) Antibody

abx332497-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

COX17, Cytochrome C Oxidase Copper Chaperone (COX17) Antibody

abx231895-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

COX17 Conjugated Antibody

C43251 100ul
EUR 397

COX17 Blocking Peptide

AF0626-BP 1mg
EUR 195

anti- COX17 antibody

FNab01895 100µg
EUR 505.25
  • Immunogen: COX17 cytochrome c oxidase assembly homolog(S. cerevisiae)
  • Uniprot ID: Q14061
  • Gene ID: 10063
  • Research Area: Metabolism
Description: Antibody raised against COX17

COX17 Polyclonal Antibody

ES2033-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against COX17 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

COX17 Polyclonal Antibody

ES2033-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against COX17 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

COX17 Blocking Peptide

20-abx063646
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

COX17 Polyclonal Antibody

ABP51034-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human COX17 at AA range: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of COX17 from Human, Mouse, Rat. This COX17 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human COX17 at AA range: 1-80

COX17 Polyclonal Antibody

ABP51034-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human COX17 at AA range: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of COX17 from Human, Mouse, Rat. This COX17 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human COX17 at AA range: 1-80

COX17 Polyclonal Antibody

ABP51034-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the N-terminal region of human COX17 at AA range: 1-80
  • Applications tips:
Description: A polyclonal antibody for detection of COX17 from Human, Mouse, Rat. This COX17 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the N-terminal region of human COX17 at AA range: 1-80

Anti-COX17 Antibody

A04584 100ul
EUR 397
Description: Rabbit Polyclonal COX17 Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

COX17 Polyclonal Antibody

A64770 100 µg
EUR 570.55
Description: Ask the seller for details

COX17 Blocking Peptide

DF3558-BP 1mg
EUR 195

COX17 cloning plasmid

CSB-CL619858HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 192
  • Sequence: atgccgggtctggttgactcaaaccctgccccgcctgagtctcaggagaagaagccgctgaagccctgctgcgcttgcccggagaccaagaaggcgcgcgatgcgtgtatcatcgagaaaggagaagaacactgtggacatctaattgaggcccacaaggaatgcatgagagccct
  • Show more
Description: A cloning plasmid for the COX17 gene.

Anti-COX17 antibody

PAab01895 100 ug
EUR 355

Anti-COX17 antibody

STJ92436 200 µl
EUR 197
Description: Rabbit polyclonal to COX17.

Anti-COX17 (1A9)

YF-MA17101 100 ug
EUR 363
Description: Mouse monoclonal to COX17

Anti-COX17 (4G2)

YF-MA11241 100 ug
EUR 363
Description: Mouse monoclonal to COX17

COX17, Cytochrome C Oxidase Copper Chaperone (COX17) Antibody (HRP)

20-abx306975
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

COX17, Cytochrome C Oxidase Copper Chaperone (COX17) Antibody (FITC)

20-abx306976
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

COX17, Cytochrome C Oxidase Copper Chaperone (COX17) Antibody (Biotin)

20-abx306977
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human COX17, Cytochrome C Oxidase Copper Chaperone (COX17) ELISA Kit

abx386648-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Canine COX17 ELISA KIT

ELI-10378d 96 Tests
EUR 928

COX17 ELISA KIT|Human

EF008817 96 Tests
EUR 689

Human COX17 shRNA Plasmid

20-abx956779
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse COX17 shRNA Plasmid

20-abx969775
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

COX17 Antibody, HRP conjugated

1-CSB-PA619858LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against COX17. Recognizes COX17 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

COX17 Antibody, FITC conjugated

1-CSB-PA619858LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against COX17. Recognizes COX17 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

COX17 Antibody, Biotin conjugated

1-CSB-PA619858LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against COX17. Recognizes COX17 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

COX17 Recombinant Protein (Human)

RP007771 100 ug Ask for price

COX17 Recombinant Protein (Rat)

RP195998 100 ug Ask for price

COX17 Recombinant Protein (Mouse)

RP125609 100 ug Ask for price

Polyclonal COX17 Antibody (aa1-50)

APG02708G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human COX17 (aa1-50). This antibody is tested and proven to work in the following applications:

COX17 Polyclonal Antibody, HRP Conjugated

A64771 100 µg
EUR 570.55
Description: The best epigenetics products

COX17 Polyclonal Antibody, FITC Conjugated

A64772 100 µg
EUR 570.55
Description: kits suitable for this type of research

COX17 Polyclonal Antibody, Biotin Conjugated

A64773 100 µg
EUR 570.55
Description: fast delivery possible

COX17 ORF Vector (Human) (pORF)

ORF002591 1.0 ug DNA
EUR 95

Cox17 ORF Vector (Rat) (pORF)

ORF065334 1.0 ug DNA
EUR 506

Cox17 ORF Vector (Mouse) (pORF)

ORF041871 1.0 ug DNA
EUR 506

COX17 sgRNA CRISPR Lentivector set (Human)

K0497501 3 x 1.0 ug
EUR 339

Cox17 sgRNA CRISPR Lentivector set (Mouse)

K4504101 3 x 1.0 ug
EUR 339

Cox17 sgRNA CRISPR Lentivector set (Rat)

K7083501 3 x 1.0 ug
EUR 339

Monoclonal COX17 Antibody (clone 4G2), Clone: 4G2

APG02709G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human COX17 (clone 4G2). The antibodies are raised in Mouse and are from clone 4G2. This antibody is applicable in WB and IHC-P, E

Monoclonal COX17 Antibody (monoclonal) (M01), Clone: 4G2

APG02710G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human COX17 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4G2. This antibody is applicable in WB and IHC, E

COX17 sgRNA CRISPR Lentivector (Human) (Target 1)

K0497502 1.0 ug DNA
EUR 154

COX17 sgRNA CRISPR Lentivector (Human) (Target 2)

K0497503 1.0 ug DNA
EUR 154

COX17 sgRNA CRISPR Lentivector (Human) (Target 3)

K0497504 1.0 ug DNA
EUR 154