Human Complement Factor P (CFP) ELISA Kit

DLR-CFP-Hu-96T 96T
EUR 621
  • Should the Human Complement Factor P (CFP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Complement Factor P (CFP) in samples from serum, plasma or other biological fluids.

Human Complement Factor P (CFP) ELISA Kit

RD-CFP-Hu-48Tests 48 Tests
EUR 478

Human Complement Factor P (CFP) ELISA Kit

RD-CFP-Hu-96Tests 96 Tests
EUR 662

Human Complement Factor P (CFP) ELISA Kit

RDR-CFP-Hu-48Tests 48 Tests
EUR 500

Human Complement Factor P (CFP) ELISA Kit

RDR-CFP-Hu-96Tests 96 Tests
EUR 692

Mouse Cardiac Fatty acid binding protein (CFP/FABP) ELISA kit

600-310-CFP 1 Kit
EUR 834


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CFP antibody

70R-5908 50 ug
EUR 467
Description: Rabbit polyclonal CFP antibody raised against the N terminal of CFP

CFP antibody

70R-5909 50 ug
EUR 467
Description: Rabbit polyclonal CFP antibody raised against the middle region of CFP

CFP Antibody

ABD7320 100 ug
EUR 438

CFP Antibody

32828-100ul 100ul
EUR 252

CFP antibody

20R-1864 100 ug
EUR 673
Description: Rabbit polyclonal CFP antibody

CFP Antibody

EUR 370

CFP Antibody

EUR 146

CFP antibody

70R-12454 100 ug
EUR 460
Description: Rabbit polyclonal CFP antibody

CFP Antibody

DF7320 200ul
EUR 304
Description: CFP Antibody detects endogenous levels of total CFP.

pA7- CFP

PVT11194 2 ug
EUR 301


PVT14405 2 ug
EUR 599

CFP expression Adenovirus

AVP002 1x109 IFU/ml x 200ul
EUR 349
Description: pre-made CFP expression adenovirus, provided in DMEM medium.

CFP Conjugated Antibody

C32828 100ul
EUR 397

CFP cloning plasmid

CSB-CL005291HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1410
  • Sequence: atgatcacagagggagcgcaggcccctcgattgttgctgccgccgctgctcctgctgctcaccctgccagccacaggctcagaccccgtgctctgcttcacccagtatgaagaatcctccggcaagtgcaagggcctcctggggggtggtgtcagcgtggaagactgctgtctca
  • Show more
Description: A cloning plasmid for the CFP gene.

anti- CFP antibody

FNab01622 100µg
EUR 505.25
  • Immunogen: complement factor properdin
  • Uniprot ID: P27918
  • Gene ID: 5199
  • Research Area: Immunology
Description: Antibody raised against CFP

Properdin (CFP) Antibody

abx034581-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Properdin (CFP) Antibody

abx034581-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Properdin (CFP) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Properdin (CFP) Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Anti-CFP Antibody

A00852-2 100ug/vial
EUR 334

CFP Rabbit pAb

A5398-100ul 100 ul
EUR 308

CFP Rabbit pAb

A5398-200ul 200 ul
EUR 459

CFP Rabbit pAb

A5398-20ul 20 ul
EUR 183

CFP Rabbit pAb

A5398-50ul 50 ul
EUR 223

CFP Rabbit pAb

A16414-100ul 100 ul
EUR 308

CFP Rabbit pAb

A16414-200ul 200 ul
EUR 459

CFP Rabbit pAb

A16414-20ul 20 ul
EUR 183

CFP Rabbit pAb

A16414-50ul 50 ul
EUR 223

CFP Rabbit pAb

A16415-100ul 100 ul
EUR 308

CFP Rabbit pAb

A16415-200ul 200 ul
EUR 459

CFP Rabbit pAb

A16415-20ul 20 ul
EUR 183

CFP Rabbit pAb

A16415-50ul 50 ul
EUR 223

CFP Blocking Peptide

33R-7790 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CFP antibody, catalog no. 70R-5908

CFP Blocking Peptide

33R-8645 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CFP antibody, catalog no. 70R-5909

CFP Blocking Peptide

DF7320-BP 1mg
EUR 195

Mouse Properdin (Cfp)

  • EUR 586.00
  • EUR 299.00
  • EUR 2172.00
  • EUR 900.00
  • EUR 1442.00
  • EUR 382.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 49.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Properdin(Cfp) expressed in Yeast

Mouse Properdin (Cfp)

  • EUR 586.00
  • EUR 299.00
  • EUR 2172.00
  • EUR 900.00
  • EUR 1442.00
  • EUR 382.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 50.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Properdin(Cfp) expressed in Yeast

Mouse Properdin (Cfp)

  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 51.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Properdin(Cfp) expressed in E.coli

Anti-CFP antibody

PAab01622 100 ug
EUR 355

pRSET- CFP Plasmid

PVT0816 2 ug
EUR 325

Anti-CFP antibody

STJ27351 100 µl
EUR 277
Description: This gene encodes a plasma glycoprotein that positively regulates the alternative complement pathway of the innate immune system. This protein binds to many microbial surfaces and apoptotic cells and stabilizes the C3- and C5-convertase enzyme complexes in a feedback loop that ultimately leads to formation of the membrane attack complex and lysis of the target cell. Mutations in this gene result in two forms of properdin deficiency, which results in high susceptibility to meningococcal infections. Multiple alternatively spliced variants, encoding the same protein, have been identified.

Anti-CFP antibody

STJ118854 100 µl
EUR 277

Anti-CFP antibody

STJ118855 100 µl
EUR 277


EHC0376 96Tests
EUR 521


ELA-E1082h 96 Tests
EUR 824


EGTC0376 96Tests
EUR 521

Canine CFP ELISA Kit

ECC0376 96Tests
EUR 521

Chicken CFP ELISA Kit

ECKC0376 96Tests
EUR 521

Bovine CFP ELISA Kit

EBC0376 96Tests
EUR 521

Anserini CFP ELISA Kit

EAC0376 96Tests
EUR 521


EF002816 96 Tests
EUR 689

Porcine CFP ELISA Kit

EPC0376 96Tests
EUR 521


ERC0376 96Tests
EUR 521

Rabbit CFP ELISA Kit

ERTC0376 96Tests
EUR 521


ESC0376 96Tests
EUR 521


EMC0376 96Tests
EUR 521

Monkey CFP ELISA Kit

EMKC0376 96Tests
EUR 521

Human CFP shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CFP protein (His tag)

80R-3878 100 ug
EUR 327
Description: Purified recombinant CFP protein (His tag)

Mouse CFP shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CFP (Bsd) lentiviral particles 

LVP011 1x10e7 IFU/ml x 200ul
EUR 349
Description: Pre-made lentiviral particles expressing cyan fluorescent protein (CFP), provided in DMEM containing 10% FBS and 60ug/ml polybrene.

CFP (Neo) lentiviral particles

LVP306 1x10e7 IFU/ml x 200ul
EUR 349
Description: Pre-made lentiviral particles expressing CFP with Neomycin antibiotic marker, provided in DMEM medium with 10% FBS and 60ug/ml of polybrene.

CFP (puro) lentiviral particles

LVP342 1x10e7 IFU/ml x 200ul
EUR 349
Description: Pre-made lentiviral particles expressing CFP with Puromycin antibiotic marker, provided in DMEM medium with 10% FBS and 60ug/ml of polybrene.

HEK293-CFP stable cells

SC010 2 x 106 cell/ml x 1ml
EUR 1138
Description: Stable cell line expressing CFP with Blasticidin resistance

CFP Recombinant Protein (Human)

RP006898 100 ug Ask for price


PVT19114 2 ug
EUR 300

CFP Recombinant Protein (Rat)

RP194729 100 ug Ask for price

CFP Recombinant Protein (Mouse)

RP123755 100 ug Ask for price

Human CFP/ Properdin ELISA Kit

E0485Hu 1 Kit
EUR 571

Mouse Cfp/ Properdin ELISA Kit

E0281Mo 1 Kit
EUR 571

Guinea Pig CFP ELISA Kit

EGC0376 96Tests
EUR 521

Human CFP(Properdin) ELISA Kit

EH1217 96T
EUR 524.1
  • Detection range: 1.563-100 ng/ml
  • Uniprot ID: P27918
  • Alias: CFP/Complement Factor P/Properdin/PFC/BFD/complement factor properdin/PFCcomplement
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.938 ng/ml

Mouse Properdin, Cfp ELISA KIT

ELI-03526m 96 Tests
EUR 865

Human Properdin, CFP ELISA KIT

ELI-03527h 96 Tests
EUR 824

Rat CFP(Properdin) ELISA Kit

ER1467 96T
EUR 524.1
  • Detection range: 1.563-100 ng/ml
  • Uniprot ID: B0BNN4
  • Alias: CFP/Complement Factor P/Properdin/PFC/BFD/complement factor properdin/PFCcomplement
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.938 ng/ml

Complement Factor P (CFP) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1191.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Complement Factor P (CFP) Antibody

  • EUR 398.00
  • EUR 133.00
  • EUR 1107.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Complement Factor P (CFP) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Complement Factor P (CFP) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Cyan Fluorescent Protein (CFP) Antibody

abx412395-50ug 50 ug
EUR 495
  • Shipped within 1 week.

Complement Factor P (CFP) Antibody

abx231622-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Complement Factor P (CFP) Antibody

  • EUR 787.00
  • EUR 411.00
  • 1 mg
  • 200 ug
  • Please enquire.