  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BIRC3 Antibody

ABD7625 100 ug
EUR 438

BIRC3 Antibody

45087-100ul 100ul
EUR 252

BIRC3 Antibody

45087-50ul 50ul
EUR 187

BIRC3 antibody

10R-10730 100 ug
EUR 381
Description: Mouse monoclonal BIRC3 antibody

BIRC3 antibody

70R-16000 50 ul
EUR 435
Description: Rabbit polyclonal BIRC3 antibody

BIRC3 Antibody

DF7625 200ul
EUR 304
Description: BIRC3 Antibody detects endogenous levels of total BIRC3.

BIRC3 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against BIRC3. Recognizes BIRC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

BIRC3 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC3. Recognizes BIRC3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200


YF-PA27167 50 ug
EUR 363
Description: Mouse polyclonal to BIRC3

BIRC3 Conjugated Antibody

C45087 100ul
EUR 397

BIRC3 Rabbit pAb

A0833-100ul 100 ul
EUR 308

BIRC3 Rabbit pAb

A0833-200ul 200 ul
EUR 459

BIRC3 Rabbit pAb

A0833-20ul 20 ul
EUR 183

BIRC3 Rabbit pAb

A0833-50ul 50 ul
EUR 223

BIRC3 Blocking Peptide

DF7625-BP 1mg
EUR 195

BIRC3 cloning plasmid

CSB-CL623808HU-10ug 10ug
EUR 618
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1815
  • Sequence: atgaacatagtagaaaacagcatattcttatcaaatttgatgaaaagcgccaacacgtttgaactgaaatacgacttgtcatgtgaactgtaccgaatgtctacgtattccacttttcctgctggggttcctgtctcagaaaggagtcttgctcgtgctggtttctattacactg
  • Show more
Description: A cloning plasmid for the BIRC3 gene.

Anti-BIRC3 antibody

STJ72372 100 µg
EUR 359

Anti-BIRC3 antibody

STJ117998 100 µl
EUR 277

Polyclonal BIRC3 / cIAP2 Antibody

APG02274G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BIRC3 / cIAP2 . This antibody is tested and proven to work in the following applications:


ELI-11021d 96 Tests
EUR 928

Mouse Birc3 ELISA KIT

ELI-34700m 96 Tests
EUR 865


ELI-49405h 96 Tests
EUR 824

Human BIRC3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse BIRC3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

BIRC3 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC3. Recognizes BIRC3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

BIRC3 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC3. Recognizes BIRC3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

BIRC3 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC3. Recognizes BIRC3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-cIAP2/BIRC3 Antibody

PB9527 100ug/vial
EUR 294

BIRC3 Recombinant Protein (Human)

RP003061 100 ug Ask for price


PVT16789 2 ug
EUR 325

BIRC3 Recombinant Protein (Mouse)

RP119594 100 ug Ask for price

Polyclonal BIRC3 / cIAP2 Antibody (Internal)

APG02276G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human BIRC3 / cIAP2 (Internal). This antibody is tested and proven to work in the following applications:

BIRC3 ORF Vector (Human) (pORF)

ORF001021 1.0 ug DNA
EUR 95

Birc3 ORF Vector (Mouse) (pORF)

ORF039866 1.0 ug DNA
EUR 506

Birc3 ORF Vector (Rat) (pORF)

ORF064070 1.0 ug DNA
EUR 506

BIRC3 ELISA Kit (Human) (OKCA01116)

OKCA01116 96 Wells
EUR 846
Description: Description of target: Multi-functional protein which regulates not only caspases and apoptosis, but also modulates inflammatory signaling and immunity, mitogenic kinase signaling and cell proliferation, as well as cell invasion and metastasis. Acts as an E3 ubiquitin-protein ligase regulating NF-kappa-B signaling and regulates both canonical and non-canonical NF-kappa-B signaling by acting in opposite directions: acts as a positive regulator of the canonical pathway and suppresses constitutive activation of non-canonical NF-kappa-B signaling. The target proteins for its E3 ubiquitin-protein ligase activity include: RIPK1, RIPK2, RIPK3, RIPK4, CASP3, CASP7, CASP8, IKBKE, TRAF1, and BCL10. Acts as an important regulator of innate immune signaling via regulation of Toll-like receptors (TLRs), Nodlike receptors (NLRs) and RIG-I like receptors (RLRs), collectively referred to as pattern recognition receptors (PRRs). Protects cells from spontaneous formation of the ripoptosome, a large multi-protein complex that has the capability to kill cancer cells in a caspase-dependent and caspase-independent manner. Suppresses ripoptosome formation by ubiquitinating RIPK1 and CASP8.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 9.4 pg/mL

Polyclonal BIRC3 / cIAP2 Antibody (C-Terminus)

APG02275G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human BIRC3 / cIAP2 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal cIAP2 (BIRC3) Antibody (N-term)

APR07031G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human cIAP2 (BIRC3) (N-term). This antibody is tested and proven to work in the following applications:

BIRC3 sgRNA CRISPR Lentivector set (Human)

K0184301 3 x 1.0 ug
EUR 339

Birc3 sgRNA CRISPR Lentivector set (Mouse)

K4370001 3 x 1.0 ug
EUR 339

Birc3 sgRNA CRISPR Lentivector set (Rat)

K7054901 3 x 1.0 ug
EUR 339

Anti-BIRC3 (aa 109 -118) antibody

STJ72373 100 µg
EUR 359

BIRC3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0184302 1.0 ug DNA
EUR 154

BIRC3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0184303 1.0 ug DNA
EUR 154

BIRC3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0184304 1.0 ug DNA
EUR 154

Birc3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4370002 1.0 ug DNA
EUR 154

Birc3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4370003 1.0 ug DNA
EUR 154

Birc3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4370004 1.0 ug DNA
EUR 154

Birc3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7054902 1.0 ug DNA
EUR 154

Birc3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7054903 1.0 ug DNA
EUR 154

Birc3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7054904 1.0 ug DNA
EUR 154

BIRC3 Protein Vector (Human) (pPB-C-His)

PV004081 500 ng
EUR 329

BIRC3 Protein Vector (Human) (pPB-N-His)

PV004082 500 ng
EUR 329

BIRC3 Protein Vector (Human) (pPM-C-HA)

PV004083 500 ng
EUR 329

BIRC3 Protein Vector (Human) (pPM-C-His)

PV004084 500 ng
EUR 329

BIRC3 Protein Vector (Human) (pPB-His-MBP)

PV326954 500 ng
EUR 329

BIRC3 Protein Vector (Human) (pPB-His-GST)

PV326955 500 ng
EUR 329

BIRC3 Protein Vector (Rat) (pPB-C-His)

PV256278 500 ng
EUR 603

BIRC3 Protein Vector (Rat) (pPB-N-His)

PV256279 500 ng
EUR 603

BIRC3 Protein Vector (Rat) (pPM-C-HA)

PV256280 500 ng
EUR 603

BIRC3 Protein Vector (Rat) (pPM-C-His)

PV256281 500 ng
EUR 603

BIRC3 Protein Vector (Mouse) (pPB-C-His)

PV159462 500 ng
EUR 603

BIRC3 Protein Vector (Mouse) (pPB-N-His)

PV159463 500 ng
EUR 603

BIRC3 Protein Vector (Mouse) (pPM-C-HA)

PV159464 500 ng
EUR 603

BIRC3 Protein Vector (Mouse) (pPM-C-His)

PV159465 500 ng
EUR 603

Birc3 3'UTR Luciferase Stable Cell Line

TU201337 1.0 ml Ask for price

Birc3 3'UTR GFP Stable Cell Line

TU152756 1.0 ml Ask for price

BIRC3 3'UTR Luciferase Stable Cell Line

TU001785 1.0 ml
EUR 1394

Birc3 3'UTR Luciferase Stable Cell Line

TU102756 1.0 ml Ask for price

BIRC3 3'UTR GFP Stable Cell Line

TU051785 1.0 ml
EUR 1394

Birc3 3'UTR GFP Stable Cell Line

TU251337 1.0 ml Ask for price

Polyclonal BIRC3 (aa 109 -118) Antibody (internal region)

APG02273G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human BIRC3 (aa 109 -118) (internal region). This antibody is tested and proven to work in the following applications:

Baculoviral IAP Repeat Containing Protein 3 (BIRC3) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Baculoviral IAP Repeat-Containing Protein 3 (BIRC3) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Baculoviral IAP Repeat-Containing Protein 3 (BIRC3) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Baculoviral IAP Repeat-Containing Protein 3 (BIRC3) Antibody

abx432411-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Baculoviral IAP Repeat-Containing Protein 3 (BIRC3) Antibody

abx432412-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

BIRC3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV640429 1.0 ug DNA
EUR 682

BIRC3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV640433 1.0 ug DNA
EUR 682

BIRC3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV640434 1.0 ug DNA
EUR 682

Baculoviral IAP Repeat Containing Protein 3 (BIRC3) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Baculoviral IAP Repeat Containing Protein 3 (BIRC3) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Baculoviral IAP Repeat Containing Protein 3 (BIRC3) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

BIRC3 Protein Vector (Human) (pPM-N-D-C-HA)

PV326956 500 ng
EUR 552

BIRC3 Protein Vector (Human) (pPM-N-D-C-His)

PV326957 500 ng
EUR 552

Recombinant Saccharomyces Cerevisiae BIRC3 Protein (aa 1-109) [His]

VAng-Wyb4298-1mg 1 mg
EUR 3649
Description: Saccharomyces Cerevisiae (strain ATCC 204508 / S288c) (Bakers yeast) Baculoviral IAP Repeat Containing 3, recombinant protein.

BIRC3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0184305 3 x 1.0 ug
EUR 376

Human Baculoviral IAP Repeat-Containing Protein 3 (BIRC3) ELISA Kit

abx259482-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Birc3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4370005 3 x 1.0 ug
EUR 376