XRCC5

Human X-Ray Repair Cross Complementing 5 (XRCC5) ELISA Kit
DLR-XRCC5-Hu-96T 96T
EUR 673
  • Should the Human X-Ray Repair Cross Complementing 5 (XRCC5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human X-Ray Repair Cross Complementing 5 (XRCC5) in samples from tissue homogenates or other biological fluids.
Mouse X-Ray Repair Cross Complementing 5 (XRCC5) ELISA Kit
DLR-XRCC5-Mu-48T 48T
EUR 527
  • Should the Mouse X-Ray Repair Cross Complementing 5 (XRCC5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse X-Ray Repair Cross Complementing 5 (XRCC5) in samples from tissue homogenates or other biological fluids.
Mouse X-Ray Repair Cross Complementing 5 (XRCC5) ELISA Kit
DLR-XRCC5-Mu-96T 96T
EUR 688
  • Should the Mouse X-Ray Repair Cross Complementing 5 (XRCC5) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse X-Ray Repair Cross Complementing 5 (XRCC5) in samples from tissue homogenates or other biological fluids.
Human X-Ray Repair Cross Complementing 5 (XRCC5) ELISA Kit
RDR-XRCC5-Hu-48Tests 48 Tests
EUR 544
Human X-Ray Repair Cross Complementing 5 (XRCC5) ELISA Kit
RDR-XRCC5-Hu-96Tests 96 Tests
EUR 756
Mouse X-Ray Repair Cross Complementing 5 (XRCC5) ELISA Kit
RDR-XRCC5-Mu-48Tests 48 Tests
EUR 557
Mouse X-Ray Repair Cross Complementing 5 (XRCC5) ELISA Kit
RDR-XRCC5-Mu-96Tests 96 Tests
EUR 774
Human X-Ray Repair Cross Complementing 5 (XRCC5) ELISA Kit
RD-XRCC5-Hu-48Tests 48 Tests
EUR 521
Human X-Ray Repair Cross Complementing 5 (XRCC5) ELISA Kit
RD-XRCC5-Hu-96Tests 96 Tests
EUR 723
Mouse X-Ray Repair Cross Complementing 5 (XRCC5) ELISA Kit
RD-XRCC5-Mu-48Tests 48 Tests
EUR 533
Mouse X-Ray Repair Cross Complementing 5 (XRCC5) ELISA Kit
RD-XRCC5-Mu-96Tests 96 Tests
EUR 740
XRCC5 antibody
70R-1235 100 ug
EUR 377
Description: Rabbit polyclonal XRCC5 antibody
XRCC5 antibody
70R-21348 50 ul
EUR 435
Description: Rabbit polyclonal XRCC5 antibody
XRCC5 antibody
70R-30841 100 ug
EUR 327
Description: Rabbit polyclonal XRCC5 antibody
XRCC5 antibody
70R-14178 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal XRCC5 antibody
XRCC5 Antibody
33550-100ul 100ul
EUR 252
XRCC5 Antibody
33550-50ul 50ul
EUR 187
XRCC5 Antibody
33099-100ul 100ul
EUR 252
XRCC5 antibody
10R-1406 100 ug
EUR 512
Description: Mouse monoclonal XRCC5 antibody
XRCC5 antibody
10R-11223 100 ug
EUR 349
Description: Mouse Monoclonal XRCC5 antibody
XRCC5 Antibody
1-CSB-PA003114
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against XRCC5. Recognizes XRCC5 from Human, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000
XRCC5 Antibody
1-CSB-PA003115
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against XRCC5. Recognizes XRCC5 from Human, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000
XRCC5 Antibody
1-CSB-PA003116
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against XRCC5. Recognizes XRCC5 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000
XRCC5 Antibody
1-CSB-PA060089
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against XRCC5. Recognizes XRCC5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/5000
XRCC5 Antibody
CSB-PA068028-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against XRCC5. Recognizes XRCC5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
XRCC5 Antibody
CSB-PA068028-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against XRCC5. Recognizes XRCC5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
XRCC5 Antibody
1-CSB-PA026233DSR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against XRCC5. Recognizes XRCC5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200
XRCC5 Antibody
1-CSB-PA026233GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against XRCC5. Recognizes XRCC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
XRCC5 Antibody
1-CSB-PA026233HA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against XRCC5. Recognizes XRCC5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IP:1:200-1:2000
XRCC5 Antibody
1-CSB-PA026233LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against XRCC5. Recognizes XRCC5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200
XRCC5 antibody
70R-33812 100 ug
EUR 327
Description: Rabbit polyclonal XRCC5 antibody
XRCC5 Antibody
BF0183 200ul
EUR 376
Description: XRCC5 antibody detects endogenous levels of total XRCC5.
XRCC5 siRNA
20-abx940032
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
XRCC5 siRNA
20-abx940033
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Ku80 (XRCC5) antibody
22944-100ul 100ul
EUR 390
XRCC5 Rabbit pAb
A0884-100ul 100 ul
EUR 384
XRCC5 Rabbit pAb
A0884-200ul 200 ul Ask for price
XRCC5 Rabbit pAb
A0884-20ul 20 ul Ask for price
XRCC5 Rabbit pAb
A0884-50ul 50 ul
EUR 265
XRCC5 Rabbit pAb
A13369-100ul 100 ul
EUR 308
XRCC5 Rabbit pAb
A13369-200ul 200 ul
EUR 459
XRCC5 Rabbit pAb
A13369-20ul 20 ul
EUR 183
XRCC5 Rabbit pAb
A13369-50ul 50 ul
EUR 223
XRCC5 Blocking Peptide
33R-3345 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of XRCC5 antibody, catalog no. 70R-1235
XRCC6/XRCC5 Antibody
CSB-PA834315-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against XRCC6/XRCC5. Recognizes XRCC6/XRCC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500
XRCC6/XRCC5 Antibody
CSB-PA834315-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against XRCC6/XRCC5. Recognizes XRCC6/XRCC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF;WB:1:500-1:3000, IHC:1:50-1:100, IF:1:100-1:500
XRCC5 Conjugated Antibody
C33099 100ul
EUR 397
XRCC5 Blocking Peptide
BF0183-BP 1mg
EUR 195
XRCC6 / XRCC5 Antibody
abx332334-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
XRCC5 cloning plasmid
CSB-CL026233HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2199
  • Sequence: atggtgcggtcggggaataaggcagctgttgtgctgtgtatggacgtgggctttaccatgagtaactccattcctggtatagaatccccatttgaacaagcaaagaaggtgataaccatgtttgtacagcgacaggtgtttgctgagaacaaggatgagattgctttagtcctgt
  • Show more
Description: A cloning plasmid for the XRCC5 gene.
XRCC5 Rabbit pAb
A5862-100ul 100 ul
EUR 308
XRCC5 Rabbit pAb
A5862-200ul 200 ul
EUR 459
XRCC5 Rabbit pAb
A5862-20ul 20 ul
EUR 183
XRCC5 Rabbit pAb
A5862-50ul 50 ul
EUR 223
XRCC5 Polyclonal Antibody
A61806 100 µg
EUR 570.55
Description: fast delivery possible
anti-XRCC5 (5C5)
LF-MA30600 100 ul
EUR 527
Description: Mouse Monoclonal to XRCC5
Anti-XRCC5 antibody
STJ28425 100 µl
EUR 277
Description: The protein encoded by this gene is the 80-kilodalton subunit of the Ku heterodimer protein which is also known as ATP-dependant DNA helicase II or DNA repair protein XRCC5. Ku is the DNA-binding component of the DNA-dependent protein kinase, and it functions together with the DNA ligase IV-XRCC4 complex in the repair of DNA double-strand break by non-homologous end joining and the completion of V(D)J recombination events. This gene functionally complements Chinese hamster xrs-6, a mutant defective in DNA double-strand break repair and in ability to undergo V(D)J recombination. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity.
Anti-XRCC5 antibody
STJ114906 100 µl
EUR 393
Description: The protein encoded by this gene is the 80-kilodalton subunit of the Ku heterodimer protein which is also known as ATP-dependant DNA helicase II or DNA repair protein XRCC5. Ku is the DNA-binding component of the DNA-dependent protein kinase, and it functions together with the DNA ligase IV-XRCC4 complex in the repair of DNA double-strand break by non-homologous end joining and the completion of V(D)J recombination events. This gene functionally complements Chinese hamster xrs-6, a mutant defective in DNA double-strand break repair and in ability to undergo V(D)J recombination. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity.
Anti-XRCC5 antibody
STJ115332 100 µl
EUR 277
Description: The protein encoded by this gene is the 80-kilodalton subunit of the Ku heterodimer protein which is also known as ATP-dependant DNA helicase II or DNA repair protein XRCC5. Ku is the DNA-binding component of the DNA-dependent protein kinase, and it functions together with the DNA ligase IV-XRCC4 complex in the repair of DNA double-strand break by non-homologous end joining and the completion of V(D)J recombination events. This gene functionally complements Chinese hamster xrs-6, a mutant defective in DNA double-strand break repair and in ability to undergo V(D)J recombination. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity.
Anti-XRCC5 Antibody
STJ193184 200 µl
EUR 197
Phospho-XRCC5 (T714) Antibody
1-CSB-PA060088
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-XRCC5 (T714). Recognizes Phospho-XRCC5 (T714) from Human, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000
XRCC5 Antibody, HRP conjugated
1-CSB-PA026233HB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against XRCC5. Recognizes XRCC5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
XRCC5 Antibody, FITC conjugated
1-CSB-PA026233HC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against XRCC5. Recognizes XRCC5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
XRCC5 Antibody, Biotin conjugated
1-CSB-PA026233HD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against XRCC5. Recognizes XRCC5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
XRCC5 Antibody, HRP conjugated
1-CSB-PA026233LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against XRCC5. Recognizes XRCC5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
XRCC5 Antibody, FITC conjugated
1-CSB-PA026233LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against XRCC5. Recognizes XRCC5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
XRCC5 Antibody, Biotin conjugated
1-CSB-PA026233LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against XRCC5. Recognizes XRCC5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Mouse Xrcc5 ELISA KIT
ELI-17966m 96 Tests
EUR 865
Human XRCC5 ELISA KIT
ELI-51535h 96 Tests
EUR 824
Mouse XRCC5 shRNA Plasmid
20-abx973423
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human XRCC5 shRNA Plasmid
20-abx955140
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
anti- XRCC5/Ku80 antibody
FNab09555 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)
  • Uniprot ID: P13010
  • Gene ID: 7520
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against XRCC5/Ku80
Anti-Ku80/XRCC5 Antibody
PA1641 100ug/vial
EUR 334
Anti-Ku80/XRCC5 Antibody
PA1641-1 100ug/vial
EUR 334
Anti-XRCC5/Ku80 antibody
PAab09555 100 ug
EUR 412