XPNPEP2

XPNPEP2 antibody
70R-5336 50 ug
EUR 467
Description: Rabbit polyclonal XPNPEP2 antibody
XPNPEP2 antibody
23077-100ul 100ul
EUR 390
XPNPEP2 antibody
23078-100ul 100ul
EUR 390
XPNPEP2 antibody
70R-13331 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal XPNPEP2 antibody
XPNPEP2 antibody
70R-13347 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal XPNPEP2 antibody
XPNPEP2 cloning plasmid
CSB-CL026219HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2025
  • Sequence: atggcccgggctcactggggctgctgcccctggctggtcctcctctgtgcttgtgcctggggccacacaaagccagtggaccttggagggcaggatgtgagaaactgttccaccaaccccccttaccttccagttactgtggtcaataccacaatgtcactcacagccctccgcc
  • Show more
Description: A cloning plasmid for the XPNPEP2 gene.
XPNPEP2 Rabbit pAb
A10255-100ul 100 ul
EUR 308
XPNPEP2 Rabbit pAb
A10255-200ul 200 ul
EUR 459
XPNPEP2 Rabbit pAb
A10255-20ul 20 ul
EUR 183
XPNPEP2 Rabbit pAb
A10255-50ul 50 ul
EUR 223
XPNPEP2 Blocking Peptide
33R-7464 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of XPNPEP2 antibody, catalog no. 70R-5336
XPNPEP2 Polyclonal Antibody
27346-100ul 100ul
EUR 252
XPNPEP2 Polyclonal Antibody
27346-50ul 50ul
EUR 187
Anti-XPNPEP2 antibody
STJ112293 100 µl
EUR 277
Description: Aminopeptidase P is a hydrolase specific for N-terminal imido bonds, which are common to several collagen degradation products, neuropeptides, vasoactive peptides, and cytokines. Structurally, the enzyme is a member of the 'pita bread fold' family and occurs in mammalian tissues in both soluble and GPI-anchored membrane-bound forms. A membrane-bound and soluble form of this enzyme have been identified as products of two separate genes.
Polyclonal XPNPEP2 Antibody (Center)
APR10770G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human XPNPEP2 (Center). This antibody is tested and proven to work in the following applications:
XPNPEP2 Polyclonal Conjugated Antibody
C27346 100ul
EUR 397
Human XPNPEP2 shRNA Plasmid
20-abx955134
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
XPNPEP2 Recombinant Protein (Human)
RP044890 100 ug Ask for price
XPNPEP2 Recombinant Protein (Rat)
RP237632 100 ug Ask for price
XPNPEP2 Recombinant Protein (Mouse)
RP185882 100 ug Ask for price
Polyclonal XPNPEP2 Antibody (aa198-476)
APR10768G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human XPNPEP2 (aa198-476). This antibody is tested and proven to work in the following applications:
Polyclonal XPNPEP2 Antibody (aa286-564)
APR10769G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human XPNPEP2 (aa286-564). This antibody is tested and proven to work in the following applications:
Xpnpep2 ORF Vector (Rat) (pORF)
ORF079212 1.0 ug DNA
EUR 506
XPNPEP2 ORF Vector (Human) (pORF)
ORF014964 1.0 ug DNA
EUR 354
Xpnpep2 ORF Vector (Mouse) (pORF)
ORF061962 1.0 ug DNA
EUR 506
Rabbit Anti-Human XPNPEP2 polyclonal antibody
CABT-BL135 100 ul
EUR 585
Xaa-Pro Aminopeptidase 2 (XPNPEP2) Antibody
20-abx126797
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
XPNPEP2 sgRNA CRISPR Lentivector set (Human)
K2650501 3 x 1.0 ug
EUR 339
Xpnpep2 sgRNA CRISPR Lentivector set (Mouse)
K3174201 3 x 1.0 ug
EUR 339
Xpnpep2 sgRNA CRISPR Lentivector set (Rat)
K7076101 3 x 1.0 ug
EUR 339
XPNPEP2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2650502 1.0 ug DNA
EUR 154
XPNPEP2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2650503 1.0 ug DNA
EUR 154
XPNPEP2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2650504 1.0 ug DNA
EUR 154
Xpnpep2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3174202 1.0 ug DNA
EUR 154
Xpnpep2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3174203 1.0 ug DNA
EUR 154
Xpnpep2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3174204 1.0 ug DNA
EUR 154
Xpnpep2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7076102 1.0 ug DNA
EUR 154
Xpnpep2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7076103 1.0 ug DNA
EUR 154
Xpnpep2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7076104 1.0 ug DNA
EUR 154
XPNPEP2 Protein Vector (Human) (pPB-C-His)
PV059853 500 ng
EUR 481
XPNPEP2 Protein Vector (Human) (pPB-N-His)
PV059854 500 ng
EUR 481
XPNPEP2 Protein Vector (Human) (pPM-C-HA)
PV059855 500 ng
EUR 481
XPNPEP2 Protein Vector (Human) (pPM-C-His)
PV059856 500 ng
EUR 481
XPNPEP2 Protein Vector (Rat) (pPB-C-His)
PV316846 500 ng
EUR 1166
XPNPEP2 Protein Vector (Rat) (pPB-N-His)
PV316847 500 ng
EUR 1166
XPNPEP2 Protein Vector (Rat) (pPM-C-HA)
PV316848 500 ng
EUR 1166
XPNPEP2 Protein Vector (Rat) (pPM-C-His)
PV316849 500 ng
EUR 1166
XPNPEP2 Protein Vector (Mouse) (pPB-C-His)
PV247846 500 ng
EUR 1065
XPNPEP2 Protein Vector (Mouse) (pPB-N-His)
PV247847 500 ng
EUR 1065
XPNPEP2 Protein Vector (Mouse) (pPM-C-HA)
PV247848 500 ng
EUR 1065
XPNPEP2 Protein Vector (Mouse) (pPM-C-His)
PV247849 500 ng
EUR 1065
Xpnpep2 3'UTR GFP Stable Cell Line
TU172389 1.0 ml Ask for price
XPNPEP2 3'UTR GFP Stable Cell Line
TU078601 1.0 ml
EUR 1521
Xpnpep2 3'UTR Luciferase Stable Cell Line
TU122389 1.0 ml Ask for price
XPNPEP2 3'UTR Luciferase Stable Cell Line
TU028601 1.0 ml
EUR 1521
Xpnpep2 3'UTR Luciferase Stable Cell Line
TU223476 1.0 ml Ask for price
Xpnpep2 3'UTR GFP Stable Cell Line
TU273476 1.0 ml Ask for price
Porcine Xaa- Pro aminopeptidase 2, XPNPEP2 ELISA KIT
ELI-17534p 96 Tests
EUR 928
Human Xaa- Pro aminopeptidase 2, XPNPEP2 ELISA KIT
ELI-28775h 96 Tests
EUR 824
XPNPEP2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV656143 1.0 ug DNA
EUR 1355
XPNPEP2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV656147 1.0 ug DNA
EUR 1355
XPNPEP2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV656148 1.0 ug DNA
EUR 1355
XPNPEP2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2650505 3 x 1.0 ug
EUR 376
Xpnpep2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3174205 3 x 1.0 ug
EUR 376
Xpnpep2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7076105 3 x 1.0 ug
EUR 376
XPNPEP2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2650506 1.0 ug DNA
EUR 167
XPNPEP2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2650507 1.0 ug DNA
EUR 167
XPNPEP2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2650508 1.0 ug DNA
EUR 167
Xpnpep2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3174206 1.0 ug DNA
EUR 167
Xpnpep2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3174207 1.0 ug DNA
EUR 167
Xpnpep2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3174208 1.0 ug DNA
EUR 167
XPNPEP2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV656144 1.0 ug DNA
EUR 1355
XPNPEP2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV656145 1.0 ug DNA
EUR 1413
XPNPEP2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV656146 1.0 ug DNA
EUR 1413
Xpnpep2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7076106 1.0 ug DNA
EUR 167