WIPI2

WIPI2 Antibody
AF2734 200ul
EUR 304
Description: WIPI2 Antibody detects endogenous levels of WIPI2.
WIPI2 siRNA
20-abx906088
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
WIPI2 siRNA
20-abx939859
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
WIPI2 siRNA
20-abx939860
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
WIPI2 antibody
70R-21322 50 ul
EUR 435
Description: Rabbit polyclonal WIPI2 antibody
WIPI2 Antibody
43814-100ul 100ul
EUR 252
WIPI2 antibody
10-2587 250 ug
EUR 492
Description: Mouse monoclonal WIPI2 antibody
WIPI2 Antibody
1-CSB-PA896519ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against WIPI2. Recognizes WIPI2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
WIPI2 Antibody
1-CSB-PA531726
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against WIPI2. Recognizes WIPI2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/50-1/200.ELISA:1/10000
WIPI2 Antibody
1-CSB-PA026118GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against WIPI2. Recognizes WIPI2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
pOTB7-WIPI2
PVT19071 2 ug
EUR 231
WIPI2 Blocking Peptide
AF2734-BP 1mg
EUR 195
WIPI2 Conjugated Antibody
C43814 100ul
EUR 397
WIPI2 Polyclonal Antibody
EA358-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 from Human/ Mouse/ Rat. This antibody is tested and validated for IHC
WIPI2 Polyclonal Antibody
EA358-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 from Human/ Mouse/ Rat. This antibody is tested and validated for IHC
anti- WIPI2 antibody
FNab09513 100µg
EUR 585
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: WD repeat domain, phosphoinositide interacting 2
  • Uniprot ID: Q9Y4P8
  • Gene ID: 26100
  • Research Area: Metabolism
Description: Antibody raised against WIPI2
WIPI2 Rabbit pAb
A4610-100ul 100 ul
EUR 308
WIPI2 Rabbit pAb
A4610-200ul 200 ul
EUR 459
WIPI2 Rabbit pAb
A4610-20ul 20 ul Ask for price
WIPI2 Rabbit pAb
A4610-50ul 50 ul Ask for price
WIPI2 Rabbit pAb
A7537-100ul 100 ul
EUR 308
WIPI2 Rabbit pAb
A7537-200ul 200 ul
EUR 459
WIPI2 Rabbit pAb
A7537-20ul 20 ul
EUR 183
WIPI2 Rabbit pAb
A7537-50ul 50 ul
EUR 223
WIPI2 cloning plasmid
CSB-CL896519HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1311
  • Sequence: atgaacctggcgagccagagcggggaggccggcgccggccagctgctcttcgccaacttcaaccaggacaacacgtccctagctgttggtagtaagtccggttataaatttttctccctttcttctgtggataagctggaacagatctatgaatgcaccgatacggaagatgtgt
  • Show more
Description: A cloning plasmid for the WIPI2 gene.
Anti-WIPI2 antibody
PAab09513 100 ug
EUR 412
Anti-WIPI2 antibody
STJ98939 200 µl
EUR 197
Description: Rabbit polyclonal to WIPI2.
Anti-WIPI2 antibody
STJ29675 100 µl
EUR 277
Anti-WIPI2 antibody
STJ111226 100 µl
EUR 277
Phospho-WIPI2 (Ser413) Antibody
AF2434 200ul
EUR 304
Description: Phospho-WIPI2 (Ser413) Antibody detects endogenous levels of WIPI2.
Mouse WIPI2 shRNA Plasmid
20-abx978321
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat WIPI2 shRNA Plasmid
20-abx988319
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human WIPI2 ELISA KIT
ELI-22517h 96 Tests
EUR 824
WIPI2 ELISA KIT|Human
EF004298 96 Tests
EUR 689
WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
WIPI2 Rabbit Polyclonal Antibody
ES8580-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
Chicken WIPI2 ELISA KIT
ELI-51086c 96 Tests
EUR 928
Mouse Wipi2 ELISA KIT
ELI-51509m 96 Tests
EUR 865
WIPI2 Rabbit Polyclonal Antibody
ABP57587-003ml 0.03ml
EUR 158
  • Immunogen information: Recombinant Protein of WIPI2
  • Applications tips:
Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2
WIPI2 Rabbit Polyclonal Antibody
ABP57587-01ml 0.1ml
EUR 289
  • Immunogen information: Recombinant Protein of WIPI2
  • Applications tips:
Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2
WIPI2 Rabbit Polyclonal Antibody
ABP57587-02ml 0.2ml
EUR 414
  • Immunogen information: Recombinant Protein of WIPI2
  • Applications tips:
Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2
Phospho- WIPI2 (Ser413) Antibody
ABF3800 100 ug
EUR 438
Human WIPI2 shRNA Plasmid
20-abx958711
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
WIPI2 Recombinant Protein (Human)
RP034804 100 ug Ask for price
WIPI2 Recombinant Protein (Rat)
RP237440 100 ug Ask for price
WIPI2 Recombinant Protein (Mouse)
RP185609 100 ug Ask for price
Antibody for Human WIPI2
SPC-649D 0.1mg
EUR 354
Description: A polyclonal antibody for WIPI2 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human WIPI2. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This WIPI2 antibody is unconjugated.
Antibody for Human WIPI2
SPC-649D-A390 0.1mg
EUR 401
Description: A polyclonal antibody for WIPI2 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human WIPI2. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This WIPI2 antibody is conjugated to ATTO 390.
Antibody for Human WIPI2
SPC-649D-A488 0.1mg
EUR 400
Description: A polyclonal antibody for WIPI2 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human WIPI2. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This WIPI2 antibody is conjugated to ATTO 488.
Antibody for Human WIPI2
SPC-649D-A565 0.1mg
EUR 400
Description: A polyclonal antibody for WIPI2 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human WIPI2. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This WIPI2 antibody is conjugated to ATTO 565.
Antibody for Human WIPI2
SPC-649D-A594 0.1mg
EUR 400
Description: A polyclonal antibody for WIPI2 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human WIPI2. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This WIPI2 antibody is conjugated to ATTO 594.
Antibody for Human WIPI2
SPC-649D-A633 0.1mg
EUR 400
Description: A polyclonal antibody for WIPI2 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human WIPI2. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This WIPI2 antibody is conjugated to ATTO 633.
Antibody for Human WIPI2
SPC-649D-A655 0.1mg
EUR 400
Description: A polyclonal antibody for WIPI2 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human WIPI2. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This WIPI2 antibody is conjugated to ATTO 655.
Antibody for Human WIPI2
SPC-649D-A680 0.1mg
EUR 400
Description: A polyclonal antibody for WIPI2 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human WIPI2. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This WIPI2 antibody is conjugated to ATTO 680.
Antibody for Human WIPI2
SPC-649D-A700 0.1mg
EUR 400
Description: A polyclonal antibody for WIPI2 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human WIPI2. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This WIPI2 antibody is conjugated to ATTO 700.
Antibody for Human WIPI2
SPC-649D-ALP 0.1mg
EUR 394
Description: A polyclonal antibody for WIPI2 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human WIPI2. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This WIPI2 antibody is conjugated to Alkaline Phosphatase.
Antibody for Human WIPI2
SPC-649D-APC 0.1mg
EUR 399
Description: A polyclonal antibody for WIPI2 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human WIPI2. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This WIPI2 antibody is conjugated to APC .
Antibody for Human WIPI2
SPC-649D-APCCY7 0.1mg
EUR 471
Description: A polyclonal antibody for WIPI2 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human WIPI2. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This WIPI2 antibody is conjugated to APC/Cy7.
Antibody for Human WIPI2
SPC-649D-BI 0.1mg
EUR 396
Description: A polyclonal antibody for WIPI2 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human WIPI2. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This WIPI2 antibody is conjugated to Biotin.
Antibody for Human WIPI2
SPC-649D-DY350 0.1mg
EUR 414
Description: A polyclonal antibody for WIPI2 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human WIPI2. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This WIPI2 antibody is conjugated to Dylight 350.
Antibody for Human WIPI2
SPC-649D-DY405 0.1mg
EUR 403
Description: A polyclonal antibody for WIPI2 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human WIPI2. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This WIPI2 antibody is conjugated to Dylight 405.
Antibody for Human WIPI2
SPC-649D-DY488 0.1mg
EUR 393
Description: A polyclonal antibody for WIPI2 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human WIPI2. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This WIPI2 antibody is conjugated to Dylight 488.
Antibody for Human WIPI2
SPC-649D-DY594 0.1mg
EUR 395
Description: A polyclonal antibody for WIPI2 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human WIPI2. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This WIPI2 antibody is conjugated to Dylight 594.
Antibody for Human WIPI2
SPC-649D-DY633 0.1mg
EUR 390
Description: A polyclonal antibody for WIPI2 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human WIPI2. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This WIPI2 antibody is conjugated to Dylight 633.
Antibody for Human WIPI2
SPC-649D-FITC 0.1mg
EUR 392
Description: A polyclonal antibody for WIPI2 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human WIPI2. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This WIPI2 antibody is conjugated to FITC.
Antibody for Human WIPI2
SPC-649D-HRP 0.1mg
EUR 388
Description: A polyclonal antibody for WIPI2 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human WIPI2. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This WIPI2 antibody is conjugated to HRP.
Antibody for Human WIPI2
SPC-649D-P594 0.1mg
EUR 407
Description: A polyclonal antibody for WIPI2 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human WIPI2. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This WIPI2 antibody is conjugated to PE/ATTO 594.
Antibody for Human WIPI2
SPC-649D-PCP 0.1mg
EUR 399
Description: A polyclonal antibody for WIPI2 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human WIPI2. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This WIPI2 antibody is conjugated to PerCP.
Antibody for Human WIPI2
SPC-649D-RPE 0.1mg
EUR 397
Description: A polyclonal antibody for WIPI2 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human WIPI2. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This WIPI2 antibody is conjugated to RPE .
Antibody for Human WIPI2
SPC-649D-STR 0.1mg
EUR 398
Description: A polyclonal antibody for WIPI2 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human WIPI2. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This WIPI2 antibody is conjugated to Streptavidin.
Antibody for Human WIPI2
SPC-649S 0.012mg
EUR 65
Description: A polyclonal antibody for WIPI2 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the C-terminal of Human WIPI2. The Antibody is tested and validated for WB, ICC/IF, IHC assays with the following recommended dilutions: WB (1:1000), ICC/IF (1:100); IHC (1:50). This WIPI2 antibody is unconjugated.
Phospho-WIPI2 (Ser413) Blocking Peptide
AF2434-BP 1mg
EUR 195
Wipi2 ORF Vector (Rat) (pORF)
ORF079148 1.0 ug DNA
EUR 506
WIPI2 ORF Vector (Human) (pORF)
ORF011602 1.0 ug DNA
EUR 95
Wipi2 ORF Vector (Mouse) (pORF)
ORF061871 1.0 ug DNA
EUR 506