USP14

Human Ubiquitin Specific Peptidase 14 (USP14) ELISA Kit
DLR-USP14-Hu-96T 96T
EUR 673
  • Should the Human Ubiquitin Specific Peptidase 14 (USP14) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ubiquitin Specific Peptidase 14 (USP14) in samples from tissue homogenates or other biological fluids.
Human Ubiquitin Specific Peptidase 14 (USP14) ELISA Kit
RDR-USP14-Hu-48Tests 48 Tests
EUR 544
Human Ubiquitin Specific Peptidase 14 (USP14) ELISA Kit
RDR-USP14-Hu-96Tests 96 Tests
EUR 756
Human Ubiquitin Specific Peptidase 14 (USP14) ELISA Kit
RD-USP14-Hu-48Tests 48 Tests
EUR 521
Human Ubiquitin Specific Peptidase 14 (USP14) ELISA Kit
RD-USP14-Hu-96Tests 96 Tests
EUR 723
USP14 (USP14) Antibody
20-abx116428
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
USP14 (USP14) Antibody
abx034916-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
USP14 (USP14) Antibody
abx034916-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
USP14 (USP14) Antibody
abx037633-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
USP14 (USP14) Antibody
abx031278-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
USP14 (USP14) Antibody
abx031278-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
USP14 (USP14) Antibody
abx031550-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
USP14 (USP14) Antibody
abx031550-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
USP14 (USP14) Antibody
abx239310-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
USP14 Antibody
ABD9982 100 ug
EUR 438
USP14 siRNA
20-abx939153
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
USP14 siRNA
20-abx939154
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
USP14 antibody
70R-21194 50 ul
EUR 435
Description: Rabbit polyclonal USP14 antibody
USP14 Antibody
35419-100ul 100ul
EUR 390
Usp14 Antibody
49723-100ul 100ul
EUR 333
Usp14 Antibody
49723-50ul 50ul
EUR 239
USP14 Antibody
46697-100ul 100ul
EUR 252
USP14 Antibody
6134-50
EUR 207
USP14 Antibody
DF9982 200ul
EUR 304
Description: USP14 Antibody detects endogenous levels of total USP14.
USP14 Antibody
1-CSB-PA025704GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against USP14. Recognizes USP14 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF
USP14 Antibody
1-CSB-PA025704LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP14. Recognizes USP14 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200
pOTB7-USP14
PVT18158 2 ug
EUR 231
anti-USP14
YF-PA16083 50 ul
EUR 363
Description: Mouse polyclonal to USP14
anti-USP14
YF-PA16084 50 ug
EUR 363
Description: Mouse polyclonal to USP14
anti-USP14
YF-PA16085 100 ug
EUR 403
Description: Rabbit polyclonal to USP14
anti-USP14
YF-PA25262 50 ul
EUR 334
Description: Mouse polyclonal to USP14
Polyclonal USP14 Antibody
APC00005G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Chicken that recognizes and binds to Human USP14 . This antibody is tested and proven to work in the following applications:
USP14 Conjugated Antibody
C46697 100ul
EUR 397
Usp14 Conjugated Antibody
C49723 100ul
EUR 397
USP14 cloning plasmid
CSB-CL025704HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1485
  • Sequence: atgccgctctactccgttactgtaaaatggggaaaggagaaatttgaaggtgtagaattgaatacagatgaacctccaatggtattcaaggctcagctgtttgcgttgactggagtccagcctgccagacagaaagttatggtgaaaggaggaacgctaaaggatgatgattggg
  • Show more
Description: A cloning plasmid for the USP14 gene.
anti- USP14 antibody
FNab09310 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IP: 1:500-1:5000
  • IF: 1:10-1:100
  • Immunogen: ubiquitin specific peptidase 14(tRNA-guanine transglycosylase)
  • Uniprot ID: P54578
  • Gene ID: 9097
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against USP14
USP14 Polyclonal Antibody
A54547 100 µg
EUR 570.55
Description: reagents widely cited
USP14 Rabbit pAb
A16643-100ul 100 ul
EUR 308
USP14 Rabbit pAb
A16643-200ul 200 ul
EUR 459
USP14 Rabbit pAb
A16643-20ul 20 ul
EUR 183
USP14 Rabbit pAb
A16643-50ul 50 ul
EUR 223
Human USP14 Antibody
33439-05111 150 ug
EUR 261
USP14 Inhibitor, IU1
1845-25
EUR 338
USP14 Inhibitor, IU1
1845-5
EUR 137
USP14 Blocking Peptide
DF9982-BP 1mg
EUR 195
Anti-USP14 antibody
PAab09310 100 ug
EUR 386
anti-USP14 (6D6)
LF-MA10373 100 ug
EUR 363
Description: Mouse monoclonal to USP14
Anti-USP14 antibody
STJ11100874 100 µl
EUR 413
Description: This gene encodes a member of the ubiquitin-specific processing (UBP) family of proteases that is a deubiquitinating enzyme (DUB) with His and Cys domains. This protein is located in the cytoplasm and cleaves the ubiquitin moiety from ubiquitin-fused precursors and ubiquitinylated proteins. Mice with a mutation that results in reduced expression of the ortholog of this protein are retarded for growth, develop severe tremors by 2 to 3 weeks of age followed by hindlimb paralysis and death by 6 to 10 weeks of age. Alternate transcriptional splice variants, encoding different isoforms, have been characterized.
Anti-USP14 antibody
STJ119078 100 µl
EUR 277
Anti-USP14 (1F8)
YF-MA16660 100 ug
EUR 363
Description: Mouse monoclonal to USP14
Mouse USP14 shRNA Plasmid
20-abx975151
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
USP14 ELISA KIT|Human
EF004118 96 Tests
EUR 689
Bovine USP14 ELISA KIT
ELI-51887b 96 Tests
EUR 928
Human USP14 shRNA Plasmid
20-abx956010
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
USP14 protein (His tag)
80R-2625 100 ug
EUR 322
Description: Purified recombinant Human USP14 protein (His tag)
USP14 recombinant monoclonal antibody
A5320 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human USP14 for WB, IHC, IF,ELISA
USP14 Antibody, HRP conjugated
1-CSB-PA025704LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP14. Recognizes USP14 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
USP14 Antibody, FITC conjugated
1-CSB-PA025704LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP14. Recognizes USP14 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
USP14 Antibody, Biotin conjugated
1-CSB-PA025704LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against USP14. Recognizes USP14 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
USP14 Recombinant Protein (Human)
RP034081 100 ug Ask for price
USP14 Recombinant Protein (Rat)
RP236042 100 ug Ask for price
USP14 Recombinant Protein (Mouse)
RP183332 100 ug Ask for price
USP14 Recombinant Protein (Mouse)
RP183335 100 ug Ask for price
pCMV-HA-USP14 Plasmid
PVTB00930-2a 2 ug
EUR 356
Polyclonal USP14 Antibody (C-term)
APR04489G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP14 (C-term). This antibody is tested and proven to work in the following applications:
Polyclonal USP14 Antibody (N-term)
APR04824G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human USP14 (N-term). This antibody is tested and proven to work in the following applications:
Monoclonal USP14 Antibody (N-term)
AMM04353G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human USP14 (N-term). The antibodies are raised in Mouse. This antibody is applicable in WB
USP14 Polyclonal Antibody, Biotin Conjugated
A54544 100 µg
EUR 570.55
Description: fast delivery possible
USP14 Polyclonal Antibody, FITC Conjugated
A54545 100 µg
EUR 570.55
Description: reagents widely cited
USP14 Polyclonal Antibody, HRP Conjugated
A54546 100 µg
EUR 570.55
Description: Ask the seller for details
[KO Validated] USP14 Rabbit pAb
A19998-100ul 100 ul
EUR 410
[KO Validated] USP14 Rabbit pAb
A19998-200ul 200 ul
EUR 571
[KO Validated] USP14 Rabbit pAb
A19998-20ul 20 ul
EUR 221
[KO Validated] USP14 Rabbit pAb
A19998-50ul 50 ul
EUR 287
Human USP14 Antibody (Biotin Conjugate)
33439-05121 150 ug
EUR 369