UAP1

UAP1 antibody
70R-12732 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal UAP1 antibody
UAP1 antibody
38369-100ul 100ul
EUR 252
UAP1 Antibody
1-CSB-PA618067LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UAP1. Recognizes UAP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200
UAP1 Antibody
DF6843 200ul
EUR 304
Description: UAP1 Antibody detects endogenous levels of total UAP1.
UAP1 Antibody
CSB-PA025410KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against UAP1. Recognizes UAP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200
UAP1 Antibody
CSB-PA025410KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against UAP1. Recognizes UAP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200
UAP1 siRNA
20-abx938712
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UAP1 siRNA
20-abx938713
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
UAP1 Antibody
ABD6843 100 ug
EUR 438
anti-UAP1
YF-PA14749 50 ul
EUR 363
Description: Mouse polyclonal to UAP1
anti-UAP1
YF-PA14750 50 ug
EUR 363
Description: Mouse polyclonal to UAP1
anti-UAP1
YF-PA14751 100 ug
EUR 403
Description: Rabbit polyclonal to UAP1
anti-UAP1
YF-PA24759 50 ul
EUR 334
Description: Mouse polyclonal to UAP1
UAP1 Blocking Peptide
DF6843-BP 1mg
EUR 195
UAP1 cloning plasmid
CSB-CL618067HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1518
  • Sequence: atgaacattaatgacctcaaactcacgttgtccaaagctgggcaagagcacctactacgtttctggaatgagcttgaagaagcccaacaggtagaactttatgcagagctccaggccatgaactttgaggagctgaacttctttttccaaaaggccattgaaggttttaaccagt
  • Show more
Description: A cloning plasmid for the UAP1 gene.
UAP1 Rabbit pAb
A2119-100ul 100 ul
EUR 308
UAP1 Rabbit pAb
A2119-200ul 200 ul
EUR 459
UAP1 Rabbit pAb
A2119-20ul 20 ul
EUR 183
UAP1 Rabbit pAb
A2119-50ul 50 ul
EUR 223
Anti-UAP1 antibody
STJ26005 100 µl
EUR 277
Anti-UAP1 (3A9)
YF-MA15561 100 ug
EUR 363
Description: Mouse monoclonal to UAP1
UAP1 Antibody, HRP conjugated
1-CSB-PA618067LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UAP1. Recognizes UAP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
UAP1 Antibody, FITC conjugated
1-CSB-PA618067LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UAP1. Recognizes UAP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
UAP1 Antibody, Biotin conjugated
1-CSB-PA618067LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UAP1. Recognizes UAP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Human UAP1 shRNA Plasmid
20-abx954552
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse UAP1 shRNA Plasmid
20-abx979823
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
UAP1 Recombinant Protein (Rat)
RP235463 100 ug Ask for price
UAP1 Recombinant Protein (Human)
RP033622 100 ug Ask for price
UAP1 Recombinant Protein (Mouse)
RP182528 100 ug Ask for price
Uap1 ORF Vector (Rat) (pORF)
ORF078489 1.0 ug DNA
EUR 506
UAP1 ORF Vector (Human) (pORF)
ORF011208 1.0 ug DNA
EUR 95
Uap1 ORF Vector (Mouse) (pORF)
ORF060844 1.0 ug DNA
EUR 506
Human UDP-N-acetylhexosamine pyrophosphorylase (UAP1)
1-CSB-EP618067HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 62.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human UDP-N-acetylhexosamine pyrophosphorylase(UAP1) expressed in E.coli
Polyclonal Uap1 antibody - C-terminal region
AMM08415G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Uap1 - C-terminal region. This antibody is tested and proven to work in the following applications:
Human UDP-N-acetylhexosamine pyrophosphorylase (UAP1)
1-CSB-YP618067HU
  • EUR 586.00
  • EUR 299.00
  • EUR 2172.00
  • EUR 900.00
  • EUR 1442.00
  • EUR 382.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 60.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human UDP-N-acetylhexosamine pyrophosphorylase(UAP1) expressed in Yeast
UDP-N-Acetylhexosamine Pyrophosphorylase (UAP1) Antibody
abx117213-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.
UDP-N-Acetylhexosamine Pyrophosphorylase (UAP1) Antibody
abx036318-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
UDP-N-Acetylhexosamine Pyrophosphorylase (UAP1) Antibody
20-abx302593
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
UDP-N-Acetylhexosamine Pyrophosphorylase (UAP1) Antibody
20-abx001731
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Uap1 sgRNA CRISPR Lentivector set (Rat)
K6698201 3 x 1.0 ug
EUR 339
UAP1 sgRNA CRISPR Lentivector set (Human)
K2567001 3 x 1.0 ug
EUR 339
Uap1 sgRNA CRISPR Lentivector set (Mouse)
K4696101 3 x 1.0 ug
EUR 339
UDP-N-Acetylhexosamine Pyrophosphorylase (UAP1) Antibody (HRP)
20-abx316221
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
UDP-N-Acetylhexosamine Pyrophosphorylase (UAP1) Antibody (FITC)
20-abx316222
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
UDP-N-Acetylhexosamine Pyrophosphorylase (UAP1) Antibody (Biotin)
20-abx316223
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Uap1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6698202 1.0 ug DNA
EUR 154
Uap1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6698203 1.0 ug DNA
EUR 154
Uap1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6698204 1.0 ug DNA
EUR 154
UAP1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2567002 1.0 ug DNA
EUR 154
UAP1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2567003 1.0 ug DNA
EUR 154
UAP1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2567004 1.0 ug DNA
EUR 154
Uap1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4696102 1.0 ug DNA
EUR 154
Uap1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4696103 1.0 ug DNA
EUR 154
Uap1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4696104 1.0 ug DNA
EUR 154
UAP1 Protein Vector (Mouse) (pPB-C-His)
PV243374 500 ng
EUR 603
UAP1 Protein Vector (Mouse) (pPB-N-His)
PV243375 500 ng
EUR 603
UAP1 Protein Vector (Mouse) (pPM-C-HA)
PV243376 500 ng
EUR 603
UAP1 Protein Vector (Mouse) (pPM-C-His)
PV243377 500 ng
EUR 603
UAP1 Protein Vector (Rat) (pPB-C-His)
PV313954 500 ng
EUR 603
UAP1 Protein Vector (Rat) (pPB-N-His)
PV313955 500 ng
EUR 603
UAP1 Protein Vector (Rat) (pPM-C-HA)
PV313956 500 ng
EUR 603
UAP1 Protein Vector (Rat) (pPM-C-His)
PV313957 500 ng
EUR 603
UAP1 Protein Vector (Human) (pPB-C-His)
PV044829 500 ng
EUR 329
UAP1 Protein Vector (Human) (pPB-N-His)
PV044830 500 ng
EUR 329
UAP1 Protein Vector (Human) (pPM-C-HA)
PV044831 500 ng
EUR 329
UAP1 Protein Vector (Human) (pPM-C-His)
PV044832 500 ng
EUR 329
Uap1 3'UTR Luciferase Stable Cell Line
TU121428 1.0 ml Ask for price
UAP1 3'UTR GFP Stable Cell Line
TU077607 1.0 ml
EUR 1394
Uap1 3'UTR GFP Stable Cell Line
TU171428 1.0 ml Ask for price
Uap1 3'UTR Luciferase Stable Cell Line
TU222718 1.0 ml Ask for price
UAP1 3'UTR Luciferase Stable Cell Line
TU027607 1.0 ml
EUR 1394
Uap1 3'UTR GFP Stable Cell Line
TU272718 1.0 ml Ask for price
Mouse UDP- N- acetylhexosamine pyrophosphorylase, Uap1 ELISA KIT
ELI-17856m 96 Tests
EUR 865
Human UDP- N- acetylhexosamine pyrophosphorylase, UAP1 ELISA KIT
ELI-51871h 96 Tests
EUR 824
UAP1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV623125 1.0 ug DNA
EUR 682