TBCE

TBCE antibody
70R-20717 50 ul
EUR 435
Description: Rabbit polyclonal TBCE antibody
TBCE Antibody
1-CSB-PA613603ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TBCE. Recognizes TBCE from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
TBCE Antibody
1-CSB-PA613603ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TBCE. Recognizes TBCE from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
TBCE Antibody
DF12766 200ul
EUR 304
Description: TBCE Antibody detects endogenous levels of TBCE.
TBCE Antibody
1-CSB-PA023230GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TBCE. Recognizes TBCE from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
TBCE siRNA
20-abx905479
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TBCE siRNA
20-abx936223
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
TBCE siRNA
20-abx936224
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti-TBCE
YF-PA14924 50 ug
EUR 363
Description: Mouse polyclonal to TBCE
anti-TBCE
YF-PA14925 100 ul
EUR 403
Description: Rabbit polyclonal to TBCE
anti-TBCE
YF-PA14926 100 ug
EUR 403
Description: Rabbit polyclonal to TBCE
TBCE Polyclonal Antibody
30929-100ul 100ul
EUR 252
TBCE Polyclonal Antibody
30929-50ul 50ul
EUR 187
TBCE Blocking Peptide
DF12766-BP 1mg
EUR 195
TBCE cloning plasmid
CSB-CL613603HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1584
  • Sequence: atgagtgacactttgacagcggatgtcattggtcgaagagttgaagttaatggagaacatgcaacagtacgttttgctggtgttgtccctcccgtggcaggaccctggttaggagtagaatgggacaatcccgagagaggaaagcatgatgggagccacgaagggactgtgtatt
  • Show more
Description: A cloning plasmid for the TBCE gene.
TBCE Rabbit pAb
A7453-100ul 100 ul
EUR 308
TBCE Rabbit pAb
A7453-200ul 200 ul
EUR 459
TBCE Rabbit pAb
A7453-20ul 20 ul
EUR 183
TBCE Rabbit pAb
A7453-50ul 50 ul
EUR 223
anti- TBCE antibody
FNab08520 100µg
EUR 548.75
  • Immunogen: tubulin folding cofactor E
  • Uniprot ID: Q15813
  • Gene ID: 6905
  • Research Area: Metabolism
Description: Antibody raised against TBCE
Anti-TBCE antibody
PAab08520 100 ug
EUR 386
pCMV-SPORT6-TBCE
PVT12918 2 ug
EUR 391
Anti-TBCE antibody
STJ29589 100 µl
EUR 277
Description: Cofactor E is one of four proteins (cofactors A, D, E, and C) involved in the pathway leading to correctly folded beta-tubulin from folding intermediates. Cofactors A and D are believed to play a role in capturing and stabilizing beta-tubulin intermediates in a quasi-native confirmation. Cofactor E binds to the cofactor D/beta-tubulin complex; interaction with cofactor C then causes the release of beta-tubulin polypeptides that are committed to the native state. Two transcript variants encoding the same protein have been found for this gene.
TBCE ELISA KIT|Human
EF003472 96 Tests
EUR 689
Rat TBCE shRNA Plasmid
20-abx990170
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse TBCE shRNA Plasmid
20-abx977212
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Polyclonal TBCE Antibody (Center)
APR13712G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TBCE (Center). This antibody is tested and proven to work in the following applications:
TBCE Polyclonal Conjugated Antibody
C30929 100ul
EUR 397
Human TBCE shRNA Plasmid
20-abx954731
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
TBCE Recombinant Protein (Rat)
RP232466 100 ug Ask for price
TBCE Recombinant Protein (Human)
RP031051 100 ug Ask for price
TBCE Recombinant Protein (Mouse)
RP177590 100 ug Ask for price
Tbce ORF Vector (Rat) (pORF)
ORF077490 1.0 ug DNA
EUR 506
TBCE ORF Vector (Human) (pORF)
ORF010351 1.0 ug DNA
EUR 95
Tbce ORF Vector (Mouse) (pORF)
ORF059198 1.0 ug DNA
EUR 506
Tubulin-Specific Chaperone E (TBCE) Antibody
20-abx006489
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tubulin Folding Cofactor E (TBCE) Antibody
20-abx116339
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tubulin-Specific Chaperone E (TBCE) Antibody
abx036291-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Tubulin-Specific Chaperone E (TBCE) Antibody
abx034466-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Tubulin-Specific Chaperone E (TBCE) Antibody
abx034466-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Tubulin-Specific Chaperone E (TBCE) Antibody
abx238520-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Polyclonal TBCE Antibody - C-terminal region
APR13713G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TBCE - C-terminal region. This antibody is tested and proven to work in the following applications:
Tubulin-Specific Chaperone E (TBCE) Antibody
20-abx321004
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tubulin-Specific Chaperone E (TBCE) Antibody
20-abx321911
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Tbce sgRNA CRISPR Lentivector set (Rat)
K7246901 3 x 1.0 ug
EUR 339
TBCE sgRNA CRISPR Lentivector set (Human)
K2342601 3 x 1.0 ug
EUR 339
Tbce sgRNA CRISPR Lentivector (Rat) (Target 1)
K7246902 1.0 ug DNA
EUR 154
Tbce sgRNA CRISPR Lentivector (Rat) (Target 2)
K7246903 1.0 ug DNA
EUR 154
Tbce sgRNA CRISPR Lentivector (Rat) (Target 3)
K7246904 1.0 ug DNA
EUR 154
TBCE sgRNA CRISPR Lentivector (Human) (Target 1)
K2342602 1.0 ug DNA
EUR 154
TBCE sgRNA CRISPR Lentivector (Human) (Target 2)
K2342603 1.0 ug DNA
EUR 154
TBCE sgRNA CRISPR Lentivector (Human) (Target 3)
K2342604 1.0 ug DNA
EUR 154
TBCE Protein Vector (Rat) (pPB-C-His)
PV309958 500 ng
EUR 603
TBCE Protein Vector (Rat) (pPB-N-His)
PV309959 500 ng
EUR 603
TBCE Protein Vector (Rat) (pPM-C-HA)
PV309960 500 ng
EUR 603
TBCE Protein Vector (Rat) (pPM-C-His)
PV309961 500 ng
EUR 603
TBCE Protein Vector (Human) (pPB-C-His)
PV041401 500 ng
EUR 329
TBCE Protein Vector (Human) (pPB-N-His)
PV041402 500 ng
EUR 329
TBCE Protein Vector (Human) (pPM-C-HA)
PV041403 500 ng
EUR 329
TBCE Protein Vector (Human) (pPM-C-His)
PV041404 500 ng
EUR 329
TBCE Protein Vector (Mouse) (pPB-C-His)
PV236790 500 ng
EUR 603
TBCE Protein Vector (Mouse) (pPB-N-His)
PV236791 500 ng
EUR 603
TBCE Protein Vector (Mouse) (pPM-C-HA)
PV236792 500 ng
EUR 603
TBCE Protein Vector (Mouse) (pPM-C-His)
PV236793 500 ng
EUR 603
Tbce 3'UTR Luciferase Stable Cell Line
TU221651 1.0 ml Ask for price
TBCE 3'UTR GFP Stable Cell Line
TU075230 1.0 ml
EUR 1394
Tbce 3'UTR GFP Stable Cell Line
TU271651 1.0 ml Ask for price
TBCE 3'UTR Luciferase Stable Cell Line
TU025230 1.0 ml
EUR 1394
Mouse Tubulin- specific chaperone E, Tbce ELISA KIT
ELI-17385m 96 Tests
EUR 865
Human Tubulin- specific chaperone E, TBCE ELISA KIT
ELI-28987h 96 Tests
EUR 824
Bovine Tubulin- specific chaperone E, TBCE ELISA KIT
ELI-52877b 96 Tests
EUR 928
Rat Tubulin-specific chaperone E (TBCE) ELISA Kit
abx392083-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Human Tubulin-specific chaperone E (TBCE) ELISA Kit
abx383650-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
Mouse Tubulin-specific chaperone E (TBCE) ELISA Kit
abx390801-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
TBCE Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV691303 1.0 ug DNA
EUR 682