STAMBPL1

STAMBPL1 antibody
70R-3245 50 ug
EUR 467
Description: Rabbit polyclonal STAMBPL1 antibody raised against the N terminal of STAMBPL1
STAMBPL1 siRNA
20-abx935375
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
STAMBPL1 siRNA
20-abx935376
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
STAMBPL1 Polyclonal Antibody
29469-100ul 100ul
EUR 252
STAMBPL1 Polyclonal Antibody
29469-50ul 50ul
EUR 187
STAMBPL1 Rabbit pAb
A15877-100ul 100 ul
EUR 308
STAMBPL1 Rabbit pAb
A15877-200ul 200 ul
EUR 459
STAMBPL1 Rabbit pAb
A15877-20ul 20 ul
EUR 183
STAMBPL1 Rabbit pAb
A15877-50ul 50 ul
EUR 223
STAMBPL1 Blocking Peptide
33R-5863 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of STAMBPL1 antibody, catalog no. 70R-3245
STAMBPL1 cloning plasmid
CSB-CL853417HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1266
  • Sequence: atgcctgaccatacagatgtttccctaagcccagaagagcgagtccgtgccctaagcaagcttggttgtaatatcaccatcagtgaagacatcactccacgacgttactttaggtctggagtagagatggagaggatggcgtctgtgtatttggaagaaggaaatttggaaaatg
  • Show more
Description: A cloning plasmid for the STAMBPL1 gene.
Anti-STAMBPL1 antibody
STJ118336 100 µl
EUR 277
Polyclonal STAMBPL1 Antibody (Center)
APR05609G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STAMBPL1 (Center). This antibody is tested and proven to work in the following applications:
STAMBPL1 protein (His tag)
80R-2659 50 ug
EUR 322
Description: Purified recombinant Human STAMBPL1 protein (His tag)
Mouse STAMBPL1 shRNA Plasmid
20-abx978654
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
STAMBPL1 Polyclonal Conjugated Antibody
C29469 100ul
EUR 397
Human STAMBPL1 shRNA Plasmid
20-abx961535
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
pCMV-SPORT6 .ccdb-STAMBPL1
PVT17479 2 ug
EUR 231
STAMBPL1 Recombinant Protein (Human)
RP030307 100 ug Ask for price
STAMBPL1 Recombinant Protein (Mouse)
RP175889 100 ug Ask for price
STAMBPL1 ORF Vector (Human) (pORF)
ORF010103 1.0 ug DNA
EUR 95
Stambpl1 ORF Vector (Mouse) (pORF)
ORF058631 1.0 ug DNA
EUR 506
Polyclonal STAMBPL1 Antibody - C-terminal region
APR01862G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STAMBPL1 - C-terminal region. This antibody is tested and proven to work in the following applications:
STAMBPL1 sgRNA CRISPR Lentivector set (Human)
K2299101 3 x 1.0 ug
EUR 339
Stambpl1 sgRNA CRISPR Lentivector set (Mouse)
K4710201 3 x 1.0 ug
EUR 339
Human AMSH like protease(STAMBPL1) ELISA kit
E01A2001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human AMSH like protease(STAMBPL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human AMSH like protease(STAMBPL1) ELISA kit
E01A2001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human AMSH like protease(STAMBPL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human AMSH like protease(STAMBPL1) ELISA kit
E01A2001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human AMSH like protease(STAMBPL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse AMSH like protease(STAMBPL1) ELISA kit
E03A2001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse AMSH like protease(STAMBPL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse AMSH like protease(STAMBPL1) ELISA kit
E03A2001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse AMSH like protease(STAMBPL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse AMSH like protease(STAMBPL1) ELISA kit
E03A2001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse AMSH like protease(STAMBPL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat AMSH like protease(STAMBPL1) ELISA kit
E06A2001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat AMSH like protease(STAMBPL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat AMSH like protease(STAMBPL1) ELISA kit
E06A2001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat AMSH like protease(STAMBPL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat AMSH like protease(STAMBPL1) ELISA kit
E06A2001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat AMSH like protease(STAMBPL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit AMSH like protease(STAMBPL1) ELISA kit
E04A2001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit AMSH like protease(STAMBPL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit AMSH like protease(STAMBPL1) ELISA kit
E04A2001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit AMSH like protease(STAMBPL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit AMSH like protease(STAMBPL1) ELISA kit
E04A2001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit AMSH like protease(STAMBPL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat AMSH like protease(STAMBPL1) ELISA kit
E02A2001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat AMSH like protease(STAMBPL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat AMSH like protease(STAMBPL1) ELISA kit
E02A2001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat AMSH like protease(STAMBPL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat AMSH like protease(STAMBPL1) ELISA kit
E02A2001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat AMSH like protease(STAMBPL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig AMSH like protease(STAMBPL1) ELISA kit
E07A2001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine AMSH like protease(STAMBPL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig AMSH like protease(STAMBPL1) ELISA kit
E07A2001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine AMSH like protease(STAMBPL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig AMSH like protease(STAMBPL1) ELISA kit
E07A2001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine AMSH like protease(STAMBPL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog AMSH like protease(STAMBPL1) ELISA kit
E08A2001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine AMSH like protease(STAMBPL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog AMSH like protease(STAMBPL1) ELISA kit
E08A2001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine AMSH like protease(STAMBPL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog AMSH like protease(STAMBPL1) ELISA kit
E08A2001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine AMSH like protease(STAMBPL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey AMSH like protease(STAMBPL1) ELISA kit
E09A2001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey AMSH like protease(STAMBPL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey AMSH like protease(STAMBPL1) ELISA kit
E09A2001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey AMSH like protease(STAMBPL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey AMSH like protease(STAMBPL1) ELISA kit
E09A2001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey AMSH like protease(STAMBPL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human AMSH- like protease, STAMBPL1 ELISA KIT
ELI-18925h 96 Tests
EUR 824
Mouse AMSH- like protease, Stambpl1 ELISA KIT
ELI-23664m 96 Tests
EUR 865
STAMBPL1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2299102 1.0 ug DNA
EUR 154
STAMBPL1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2299103 1.0 ug DNA
EUR 154
STAMBPL1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2299104 1.0 ug DNA
EUR 154
Stambpl1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4710202 1.0 ug DNA
EUR 154
Stambpl1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4710203 1.0 ug DNA
EUR 154
Stambpl1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4710204 1.0 ug DNA
EUR 154
STAMBPL1 Protein Vector (Human) (pPB-C-His)
PV040409 500 ng
EUR 329
STAMBPL1 Protein Vector (Human) (pPB-N-His)
PV040410 500 ng
EUR 329
STAMBPL1 Protein Vector (Human) (pPM-C-HA)
PV040411 500 ng
EUR 329
STAMBPL1 Protein Vector (Human) (pPM-C-His)
PV040412 500 ng
EUR 329
STAMBPL1 Protein Vector (Mouse) (pPB-C-His)
PV234522 500 ng
EUR 603
STAMBPL1 Protein Vector (Mouse) (pPB-N-His)
PV234523 500 ng
EUR 603
STAMBPL1 Protein Vector (Mouse) (pPM-C-HA)
PV234524 500 ng
EUR 603
STAMBPL1 Protein Vector (Mouse) (pPM-C-His)
PV234525 500 ng
EUR 603
Recombinant Human STAMBPL1 Protein, His, E.coli-10ug
QP13607-10ug 10ug
EUR 201
Recombinant Human STAMBPL1 Protein, His, E.coli-1mg
QP13607-1mg 1mg
EUR 5251
Recombinant Human STAMBPL1 Protein, His, E.coli-2ug
QP13607-2ug 2ug
EUR 155
Stambpl1 3'UTR Luciferase Stable Cell Line
TU119802 1.0 ml Ask for price
Stambpl1 3'UTR GFP Stable Cell Line
TU169802 1.0 ml Ask for price
STAMBPL1 3'UTR GFP Stable Cell Line
TU074771 1.0 ml
EUR 1521
STAMBPL1 3'UTR Luciferase Stable Cell Line
TU024771 1.0 ml
EUR 1521
Guinea pig AMSH like protease(STAMBPL1) ELISA kit
E05A2001-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig AMSH like protease(STAMBPL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig AMSH like protease(STAMBPL1) ELISA kit
E05A2001-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig AMSH like protease(STAMBPL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig AMSH like protease(STAMBPL1) ELISA kit
E05A2001-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig AMSH like protease(STAMBPL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
STAMBPL1 STAM Binding Protein Like 1 Human Recombinant Protein
PROTQ96FJ0 Regular: 10ug
EUR 317
Description: STAMBPL1 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 458 amino acids (1-436) and having a molecular mass of 52 kDa. STAMBPL1 is fused to a 22 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
STAMBPL1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2299105 3 x 1.0 ug
EUR 376
Stambpl1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4710205 3 x 1.0 ug
EUR 376
STAMBPL1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2299106 1.0 ug DNA
EUR 167
STAMBPL1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2299107 1.0 ug DNA
EUR 167
STAMBPL1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2299108 1.0 ug DNA
EUR 167
Stambpl1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4710206 1.0 ug DNA
EUR 167
Stambpl1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4710207 1.0 ug DNA
EUR 167
Stambpl1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4710208 1.0 ug DNA
EUR 167