ST3GAL2

ST3GAL2 siRNA
20-abx905305
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ST3GAL2 antibody
70R-7396 50 ug
EUR 467
Description: Rabbit polyclonal ST3GAL2 antibody raised against the C terminal of ST3GAL2
ST3GAL2 antibody
22029-100ul 100ul
EUR 390
ST3GAL2 antibody
70R-20547 50 ul
EUR 435
Description: Rabbit polyclonal ST3GAL2 antibody
ST3GAL2 antibody
70R-12762 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal ST3GAL2 antibody
ST3GAL2 siRNA
20-abx935314
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ST3GAL2 siRNA
20-abx935315
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
ST3GAL2 Antibody
1-CSB-PA618099LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST3GAL2. Recognizes ST3GAL2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA
ST3GAL2 Antibody
1-CSB-PA022752GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ST3GAL2. Recognizes ST3GAL2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
anti-ST3GAL2
YF-PA14647 50 ug
EUR 363
Description: Mouse polyclonal to ST3GAL2
anti-ST3GAL2
YF-PA14648 100 ug
EUR 403
Description: Rabbit polyclonal to ST3GAL2
ST3GAL2 cloning plasmid
CSB-CL618099HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1053
  • Sequence: atgaagtgctccctgcgggtgtggttcctctccgtggccttcctgctggtgttcatcatgtccctgctcttcacctactcgcaccacagcatggccacgctcccctacctggactcaggggccctggatgggacgcaccgggtgaagctggtgcccggctatgccggcctgcagc
  • Show more
Description: A cloning plasmid for the ST3GAL2 gene.
anti- ST3GAL2 antibody
FNab08263 100µg
EUR 548.75
  • Immunogen: ST3 beta-galactoside alpha-2,3-sialyltransferase 2
  • Uniprot ID: Q16842
  • Gene ID: 6483
  • Research Area: Metabolism
Description: Antibody raised against ST3GAL2
ST3GAL2 Polyclonal Antibody
A50913 100 µg
EUR 570.55
Description: fast delivery possible
ST3GAL2 Rabbit pAb
A13733-100ul 100 ul
EUR 308
ST3GAL2 Rabbit pAb
A13733-200ul 200 ul
EUR 459
ST3GAL2 Rabbit pAb
A13733-20ul 20 ul
EUR 183
ST3GAL2 Rabbit pAb
A13733-50ul 50 ul
EUR 223
ST3GAL2 Rabbit pAb
A8917-100ul 100 ul
EUR 308
ST3GAL2 Rabbit pAb
A8917-200ul 200 ul
EUR 459
ST3GAL2 Rabbit pAb
A8917-20ul 20 ul Ask for price
ST3GAL2 Rabbit pAb
A8917-50ul 50 ul Ask for price
ST3GAL2 Blocking Peptide
33R-1106 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EIF2B1 antibody, catalog no. 70R-3849
ST3GAL2 Polyclonal Antibody
28327-100ul 100ul
EUR 252
ST3GAL2 Polyclonal Antibody
28327-50ul 50ul
EUR 187
Anti-ST3GAL2 antibody
PAab08263 100 ug
EUR 386
Anti-ST3GAL2 antibody
STJ111479 100 µl
EUR 277
Description: The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The encoded protein is normally found in the Golgi but can be proteolytically processed to a soluble form. This protein, which is a member of glycosyltransferase family 29, can use the same acceptor substrates as does sialyltransferase 4A.
Anti-ST3GAL2 antibody
STJ115685 100 µl
EUR 277
Description: The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The encoded protein is normally found in the Golgi but can be proteolytically processed to a soluble form. This protein, which is a member of glycosyltransferase family 29, can use the same acceptor substrates as does sialyltransferase 4A.
Anti-ST3GAL2 (1E12)
YF-MA10848 100 ug
EUR 363
Description: Mouse monoclonal to ST3GAL2
ST3GAL2 Polyclonal Conjugated Antibody
C28327 100ul
EUR 397
Rat ST3GAL2 shRNA Plasmid
20-abx986238
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ST3GAL2 ELISA KIT|Human
EF003261 96 Tests
EUR 689
Human ST3GAL2 ELISA KIT
ELI-42319h 96 Tests
EUR 824
Mouse St3gal2 ELISA KIT
ELI-42320m 96 Tests
EUR 865
Human ST3GAL2 shRNA Plasmid
20-abx954382
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse ST3GAL2 shRNA Plasmid
20-abx972693
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ST3GAL2 Antibody, HRP conjugated
1-CSB-PA618099LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST3GAL2. Recognizes ST3GAL2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
ST3GAL2 Antibody, FITC conjugated
1-CSB-PA618099LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST3GAL2. Recognizes ST3GAL2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
ST3GAL2 Antibody, Biotin conjugated
1-CSB-PA618099LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST3GAL2. Recognizes ST3GAL2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
ST3GAL2 Recombinant Protein (Human)
RP030220 100 ug Ask for price
ST3GAL2 Recombinant Protein (Rat)
RP231236 100 ug Ask for price
ST3GAL2 Recombinant Protein (Mouse)
RP175751 100 ug Ask for price
pCMV-SPORT6-ST3GAL2 Plasmid
PVT16730 2 ug
EUR 325
ST3GAL2 Polyclonal Antibody, HRP Conjugated
A50914 100 µg
EUR 570.55
Description: reagents widely cited
ST3GAL2 Polyclonal Antibody, FITC Conjugated
A50915 100 µg
EUR 570.55
Description: Ask the seller for details
ST3GAL2 Polyclonal Antibody, Biotin Conjugated
A50916 100 µg
EUR 570.55
Description: The best epigenetics products
St3gal2 ORF Vector (Mouse) (pORF)
ORF058585 1.0 ug DNA
EUR 506
ST3GAL2 ORF Vector (Human) (pORF)
ORF010074 1.0 ug DNA
EUR 95
St3gal2 ORF Vector (Rat) (pORF)
ORF077080 1.0 ug DNA
EUR 506
ST3GAL2 sgRNA CRISPR Lentivector set (Human)
K2294201 3 x 1.0 ug
EUR 339
St3gal2 sgRNA CRISPR Lentivector set (Mouse)
K4521201 3 x 1.0 ug
EUR 339
St3gal2 sgRNA CRISPR Lentivector set (Rat)
K7086401 3 x 1.0 ug
EUR 339
ST3GAL2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2294202 1.0 ug DNA
EUR 154
ST3GAL2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2294203 1.0 ug DNA
EUR 154
ST3GAL2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2294204 1.0 ug DNA
EUR 154
St3gal2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4521202 1.0 ug DNA
EUR 154
St3gal2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4521203 1.0 ug DNA
EUR 154
St3gal2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4521204 1.0 ug DNA
EUR 154
St3gal2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7086402 1.0 ug DNA
EUR 154
St3gal2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7086403 1.0 ug DNA
EUR 154
St3gal2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7086404 1.0 ug DNA
EUR 154
ST3GAL2 Protein Vector (Human) (pPB-C-His)
PV040293 500 ng
EUR 329
ST3GAL2 Protein Vector (Human) (pPB-N-His)
PV040294 500 ng
EUR 329
ST3GAL2 Protein Vector (Human) (pPM-C-HA)
PV040295 500 ng
EUR 329
ST3GAL2 Protein Vector (Human) (pPM-C-His)
PV040296 500 ng
EUR 329
ST3GAL2 Protein Vector (Rat) (pPB-C-His)
PV308318 500 ng
EUR 603
ST3GAL2 Protein Vector (Rat) (pPB-N-His)
PV308319 500 ng
EUR 603
ST3GAL2 Protein Vector (Rat) (pPM-C-HA)
PV308320 500 ng
EUR 603
ST3GAL2 Protein Vector (Rat) (pPM-C-His)
PV308321 500 ng
EUR 603
ST3GAL2 Protein Vector (Mouse) (pPB-C-His)
PV234338 500 ng
EUR 603
ST3GAL2 Protein Vector (Mouse) (pPB-N-His)
PV234339 500 ng
EUR 603
ST3GAL2 Protein Vector (Mouse) (pPM-C-HA)
PV234340 500 ng
EUR 603
ST3GAL2 Protein Vector (Mouse) (pPM-C-His)
PV234341 500 ng
EUR 603
St3gal2 3'UTR GFP Stable Cell Line
TU169769 1.0 ml Ask for price
St3gal2 3'UTR Luciferase Stable Cell Line
TU119769 1.0 ml Ask for price
ST3GAL2 3'UTR GFP Stable Cell Line
TU074702 1.0 ml
EUR 1521
ST3GAL2 3'UTR Luciferase Stable Cell Line
TU024702 1.0 ml
EUR 1521
St3gal2 3'UTR Luciferase Stable Cell Line
TU221238 1.0 ml Ask for price
St3gal2 3'UTR GFP Stable Cell Line
TU271238 1.0 ml Ask for price
ST3GAL2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV656275 1.0 ug DNA
EUR 682
ST3GAL2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV656279 1.0 ug DNA
EUR 682
ST3GAL2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV656280 1.0 ug DNA
EUR 682
ST3 Beta-Galactoside Alpha-2,3-Sialyltransferase 2 (ST3GAL2) Antibody
20-abx124403
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.
St3 Beta Galactoside Alpha 2,3-Sialyltransferase 2 (ST3GAL2) Antibody
20-abx115826
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
ST3 Beta-Galactoside Alpha-2,3-Sialyltransferase 2 (ST3GAL2) Antibody
abx145261-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.