Smad5/ Rat Smad5 ELISA Kit
ELI-07010r 96 Tests
EUR 886
Smad5 Antibody
AF5119 200ul
EUR 304
Description: Smad5 Antibody detects endogenous levels of total Smad5.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SMAD5 Antibody
BF0155 200ul
EUR 376
Description: SMAD5 antibody detects endogenous levels of total SMAD5.
Smad5 Antibody
ABF5119 100 ug
EUR 438
SMAD5 antibody
70R-50029 100 ul
EUR 244
Description: Purified Polyclonal SMAD5 antibody
SMAD5 Antibody
ABD6711 100 ug
EUR 438
Smad5 Antibody
EUR 338
Smad5 Antibody
48746-100ul 100ul
EUR 333
Smad5 Antibody
48746-50ul 50ul
EUR 239
SMAD5 antibody
10R-10715 100 ug
EUR 349
Description: Mouse monoclonal SMAD5 antibody
SMAD5 Antibody
32514-100ul 100ul
EUR 252
Smad5 antibody
20R-1589 100 ug
EUR 673
Description: Rabbit polyclonal Smad5 antibody
SMAD5 antibody
70R-20385 50 ul
EUR 435
Description: Rabbit polyclonal SMAD5 antibody
SMAD5 antibody
70R-11845 100 ug
EUR 447
Description: Rabbit polyclonal SMAD5 antibody
SMAD5 Antibody
DF6711 200ul
EUR 304
Description: SMAD5 Antibody detects endogenous levels of total SMAD5.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SMAD5 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SMAD5. Recognizes SMAD5 from Human, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000
SMAD5 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SMAD5. Recognizes SMAD5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
SMAD5 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SMAD5. Recognizes SMAD5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200
SMAD5 Antibody
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SMAD5. Recognizes SMAD5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100
SMAD5 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SMAD5. Recognizes SMAD5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF
YF-PA13013 50 ul
EUR 363
Description: Mouse polyclonal to Smad5
Smad5 Blocking Peptide
AF5119-BP 1mg
EUR 195
SMAD5 Blocking Peptide
BF0155-BP 1mg
EUR 195
SMAD5 Conjugated Antibody
C32514 100ul
EUR 397
Smad5 Polyclonal Antibody
ES3817-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Smad5 from Human/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
Smad5 Polyclonal Antibody
ES3817-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Smad5 from Human/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
anti- SMAD5 antibody
FNab07998 100µg
EUR 548.75
  • Immunogen: SMAD family member 5
  • Uniprot ID: Q99717
  • Gene ID: 4090
  • Research Area: Epigenetics, Signal Transduction, Metabolism, Cardiovascular, Cancer, Developmental biology
Description: Antibody raised against SMAD5
Smad5 Polyclonal Antibody
ABP52818-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Smad5
  • Applications tips:
Description: A polyclonal antibody for detection of Smad5 from Human, Rat. This Smad5 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Smad5
Smad5 Polyclonal Antibody
ABP52818-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Smad5
  • Applications tips:
Description: A polyclonal antibody for detection of Smad5 from Human, Rat. This Smad5 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Smad5
Smad5 Polyclonal Antibody
ABP52818-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Smad5
  • Applications tips:
Description: A polyclonal antibody for detection of Smad5 from Human, Rat. This Smad5 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Smad5
SMAD5 Blocking Peptide
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
Smad5 Rabbit pAb
A0635-100ul 100 ul
EUR 308
Smad5 Rabbit pAb
A0635-200ul 200 ul
EUR 459
Smad5 Rabbit pAb
A0635-20ul 20 ul
EUR 183
Smad5 Rabbit pAb
A0635-50ul 50 ul
EUR 223
SMAD5 Rabbit pAb
A1947-100ul 100 ul
EUR 308
SMAD5 Rabbit pAb
A1947-200ul 200 ul
EUR 459
SMAD5 Rabbit pAb
A1947-20ul 20 ul
EUR 183
SMAD5 Rabbit pAb
A1947-50ul 50 ul
EUR 223
Smad5 Rabbit pAb
A14023-100ul 100 ul
EUR 308
Smad5 Rabbit pAb
A14023-200ul 200 ul
EUR 459
Smad5 Rabbit pAb
A14023-20ul 20 ul
EUR 183
Smad5 Rabbit pAb
A14023-50ul 50 ul
EUR 223
SMAD5 cloning plasmid
CSB-CL859108HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1398
  • Sequence: atgacgtcaatggccagcttgttttcttttactagtccagcagtaaagcgattgttgggctggaaacaaggtgatgaggaggagaaatgggcagaaaaggcagttgatgctttggtgaagaaactaaaaaagaaaaagggtgccatggaggaactggagaaagccttgagcagtc
  • Show more
Description: A cloning plasmid for the SMAD5 gene.
SMAD5 Blocking Peptide
DF6711-BP 1mg
EUR 195
Anti-SMAD5 antibody
PAab07998 100 ug
EUR 386
anti-SMAD5 (3H9)
LF-MA30512 100 ul
EUR 486
Description: Mouse Monoclonal to SMAD5
Anti-SMAD5 Antibody
PA2115 100ug/vial
EUR 334
Anti-Smad5 antibody
STJ98386 100 µl
EUR 234
Description: Mouse monoclonal to Smad5.
Anti-Smad5 antibody
STJ98549 100 µl
EUR 234
Description: Mouse monoclonal to Smad5.
Anti-SMAD5 antibody
STJ99081 200 µl
EUR 197
Description: Mouse monoclonal to SMAD5.
Anti-Smad5 antibody
STJ96452 200 µl
EUR 197
Description: Rabbit polyclonal to Smad5.
Anti-Smad5 antibody
STJ25608 100 µl
EUR 277
Description: The protein encoded by this gene is involved in the transforming growth factor beta signaling pathway that results in an inhibition of the proliferation of hematopoietic progenitor cells. The encoded protein is activated by bone morphogenetic proteins type 1 receptor kinase, and may be involved in cancer. Alternative splicing results in multiple transcript variants.
Anti-Smad5 antibody
STJ25609 100 µl
EUR 277
Description: The protein encoded by this gene is involved in the transforming growth factor beta signaling pathway that results in an inhibition of the proliferation of hematopoietic progenitor cells. The encoded protein is activated by bone morphogenetic proteins type 1 receptor kinase, and may be involved in cancer. Alternative splicing results in multiple transcript variants.
Anti-Smad5 antibody
STJ115958 100 µl
EUR 277
Description: The protein encoded by this gene is involved in the transforming growth factor beta signaling pathway that results in an inhibition of the proliferation of hematopoietic progenitor cells. The encoded protein is activated by bone morphogenetic proteins type 1 receptor kinase, and may be involved in cancer. Alternative splicing results in multiple transcript variants.
Anti-Smad5 (3A10)
YF-MA14079 100 ug
EUR 363
Description: Mouse monoclonal to Smad5
Anti-Smad5 (4F10)
YF-MA14080 100 ug
EUR 363
Description: Mouse monoclonal to Smad5
Anti-Smad5 (5E12)
YF-MA14081 100 ug
EUR 363
Description: Mouse monoclonal to Smad5
Anti-Smad5 (1C1)
YF-MA14082 100 ug
EUR 363
Description: Mouse monoclonal to Smad5
Anti-Smad5 (2D7)
YF-MA10541 100 ug
EUR 363
Description: Mouse monoclonal to Smad5
Human SMAD5 antisense gene protein 1, SMAD5-AS1 ELISA KIT
ELI-41464h 96 Tests
EUR 824
Rat SMAD5 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
ELI-07008c 96 Tests
EUR 928
EF003043 96 Tests
EUR 689
SMAD1 / SMAD5 / SMAD9 Antibody
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Human SMAD5 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Anti-SMAD1/SMAD5 Antibody
A00728-1 100ug/vial
EUR 294
SMAD5 recombinant monoclonal antibody
A5511 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human SMAD5 for WB, IHC, IF,ELISA
Smad1/Smad5/Smad8 Antibody
21684-100ul 100ul
EUR 252
Smad1/Smad5/Smad8 Antibody
21684-50ul 50ul
EUR 187
Mouse SMAD5 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SMAD1/SMAD5/SMAD9 Antibody
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SMAD1/SMAD5/SMAD9. Recognizes SMAD1/SMAD5/SMAD9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000
SMAD5 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SMAD5. Recognizes SMAD5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SMAD5 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SMAD5. Recognizes SMAD5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SMAD5 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SMAD5. Recognizes SMAD5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
SMAD5 Recombinant Protein (Human)
RP029347 100 ug Ask for price
SMAD5 Recombinant Protein (Rat)
RP230012 100 ug Ask for price
SMAD5 Recombinant Protein (Mouse)
RP173789 100 ug Ask for price
SMAD5 Recombinant Protein (Mouse)
RP173792 100 ug Ask for price
SMAD5 Recombinant Protein (Mouse)
RP173795 100 ug Ask for price
Polyclonal SMAD5 antibody - middle region
APR00597G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SMAD5 - middle region. This antibody is tested and proven to work in the following applications:
Monoclonal SMAD5 Antibody, Clone: 3H9
APR11175G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human SMAD5. The antibodies are raised in Mouse and are from clone 3H9. This antibody is applicable in WB and IHC, FC, ICC, E