SENP2

SENP2 antibody
22882-100ul 100ul
EUR 390
SENP2 antibody
70R-13371 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal SENP2 antibody
SENP2 antibody
70R-30802 100 ug
EUR 327
Description: Rabbit polyclonal SENP2 antibody
SENP2 Antibody
35483-100ul 100ul
EUR 390
SENP2 Antibody
42749-100ul 100ul
EUR 252
SENP2 Antibody
1-CSB-PA888026LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SENP2. Recognizes SENP2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200
SENP2 Antibody
1-CSB-PA692718
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SENP2. Recognizes SENP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
SENP2 Antibody
1-CSB-PA727078
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SENP2. Recognizes SENP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
SENP2 Antibody
DF8373 200ul
EUR 304
Description: SENP2 Antibody detects endogenous levels of total SENP2.
SENP2 Antibody
1-CSB-PA040186
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SENP2. Recognizes SENP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000
SENP2 antibody
70R-3981 50 ug
EUR 467
Description: Rabbit polyclonal SENP2 antibody raised against the middle region of SENP2
SENP2 antibody
70R-51064 100 ul
EUR 244
Description: Purified Polyclonal SENP2 antibody
SENP2 siRNA
20-abx904854
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SENP2 siRNA
20-abx932871
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SENP2 siRNA
20-abx932872
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SENP2 Antibody
ABD8373 100 ug
EUR 438
anti-SENP2
YF-PA20356 50 ug
EUR 363
Description: Mouse polyclonal to SENP2
SENP2 Blocking Peptide
33R-7961 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SENP2 antibody, catalog no. 70R-3981
SENP2 Blocking Peptide
DF8373-BP 1mg
EUR 195
Anti-SENP2 Antibody
A02329 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for SENP2 Antibody (SENP2) detection.tested for WB in Human, Mouse, Rat.
SENP2 Blocking Peptide
20-abx063939
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
SENP2 Conjugated Antibody
C42749 100ul
EUR 397
SENP2 cloning plasmid
CSB-CL888026HU-10ug 10ug
EUR 605
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1770
  • Sequence: atgtacagatggctggttaggattctcggcaccattttccgtttctgcgaccggtcggtgccccctgcccgggccctcctgaagaggcggcgctcagacagcactctgttttctacagtggacactgatgaaataccagccaaaagaccaagattagattgctttattcaccaag
  • Show more
Description: A cloning plasmid for the SENP2 gene.
SENP2 Rabbit pAb
A17994-100ul 100 ul
EUR 308
SENP2 Rabbit pAb
A17994-200ul 200 ul
EUR 459
SENP2 Rabbit pAb
A17994-20ul 20 ul
EUR 183
SENP2 Rabbit pAb
A17994-50ul 50 ul
EUR 223
SENP2 Polyclonal Antibody
ABP56016-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human SENP2 at AA range: 450-530
  • Applications tips:
Description: A polyclonal antibody for detection of SENP2 from Human, Mouse, Rat. This SENP2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human SENP2 at AA range: 450-530
SENP2 Polyclonal Antibody
ABP56016-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human SENP2 at AA range: 450-530
  • Applications tips:
Description: A polyclonal antibody for detection of SENP2 from Human, Mouse, Rat. This SENP2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human SENP2 at AA range: 450-530
SENP2 Polyclonal Antibody
ABP56016-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human SENP2 at AA range: 450-530
  • Applications tips:
Description: A polyclonal antibody for detection of SENP2 from Human, Mouse, Rat. This SENP2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human SENP2 at AA range: 450-530
SENP2 Polyclonal Antibody
ES7015-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SENP2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
SENP2 Polyclonal Antibody
ES7015-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SENP2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
pCMV-SPORT6-SENP2
PVT19047 2 ug
EUR 231
Anti-SENP2 antibody
STJ119967 100 µl
EUR 277
Anti-SENP2 antibody
STJ95602 200 µl
EUR 197
Description: Rabbit polyclonal to SENP2.
SENP2 Antibody, HRP conjugated
1-CSB-PA888026LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SENP2. Recognizes SENP2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SENP2 Antibody, FITC conjugated
1-CSB-PA888026LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SENP2. Recognizes SENP2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SENP2 Antibody, Biotin conjugated
1-CSB-PA888026LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SENP2. Recognizes SENP2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Mouse SENP2 shRNA Plasmid
20-abx978514
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat SENP2 shRNA Plasmid
20-abx986479
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SENP2 Cell ELISA Kit
abx595535-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.
Human SENP2 shRNA Plasmid
20-abx961775
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
pWPXLd-Flag-SENP2 Plasmid
PVTB01085-4a 2 ug
EUR 356
SENP2 Recombinant Protein (Human)
RP028015 100 ug Ask for price
SENP2 Recombinant Protein (Rat)
RP228059 100 ug Ask for price
SENP2 Recombinant Protein (Mouse)
RP170768 100 ug Ask for price
Polyclonal SENP2 Antibody (C-term)
APR03675G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SENP2 (C-term). This antibody is tested and proven to work in the following applications:
Polyclonal SENP2 Antibody (C-term)
APR03676G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SENP2 (C-term). This antibody is tested and proven to work in the following applications:
Senp2 ORF Vector (Rat) (pORF)
ORF076021 1.0 ug DNA
EUR 506
SENP2 ORF Vector (Human) (pORF)
ORF009339 1.0 ug DNA
EUR 95
Senp2 ORF Vector (Mouse) (pORF)
ORF056924 1.0 ug DNA
EUR 506
SUMO Specific Peptidase 2 (SENP2) Antibody
20-abx008074
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
SUMO Specific Peptidase 2 (SENP2) Antibody
abx026733-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
SUMO Specific Peptidase 2 (SENP2) Antibody
abx026733-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
SUMO Specific Peptidase 2 (SENP2) Antibody
abx026741-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
SUMO Specific Peptidase 2 (SENP2) Antibody
abx026741-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
SUMO Specific Peptidase 2 (SENP2) Antibody
20-abx119045
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
SUMO Specific Peptidase 2 (SENP2) Antibody
20-abx241287
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
SUMO Specific Peptidase 2 (SENP2) Antibody
20-abx241288
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
SENP2 Colorimetric Cell-Based ELISA Kit
EKC1512 100ul
EUR 572
SUMO Specific Peptidase 2 (SENP2) Antibody
20-abx338745
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SUMO Specific Peptidase 2 (SENP2) Antibody
20-abx328594
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Senp2 sgRNA CRISPR Lentivector set (Rat)
K6998701 3 x 1.0 ug
EUR 339
Senp2 sgRNA CRISPR Lentivector set (Mouse)
K4608901 3 x 1.0 ug
EUR 339
SENP2 sgRNA CRISPR Lentivector set (Human)
K2118601 3 x 1.0 ug
EUR 339
Recombinant Human Sentrin-Specific Protease 2/SENP2
CH01-10ug 10ug
EUR 80
Description: Supplied as a 0.2 μm filtered solution of 50mM HEPES,5% Glycerol, pH 7.4.
Recombinant Human Sentrin-Specific Protease 2/SENP2
CH01-1mg 1mg
EUR 1014
Description: Supplied as a 0.2 μm filtered solution of 50mM HEPES,5% Glycerol, pH 7.4.
Recombinant Human Sentrin-Specific Protease 2/SENP2
CH01-500ug 500ug
EUR 659
Description: Supplied as a 0.2 μm filtered solution of 50mM HEPES,5% Glycerol, pH 7.4.
Recombinant Human Sentrin-Specific Protease 2/SENP2
CH01-50ug 50ug
EUR 141
Description: Supplied as a 0.2 μm filtered solution of 50mM HEPES,5% Glycerol, pH 7.4.
SUMO Specific Peptidase 2 (SENP2) Antibody (HRP)
20-abx337588
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SUMO Specific Peptidase 2 (SENP2) Antibody (FITC)
20-abx337589
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SUMO Specific Peptidase 2 (SENP2) Antibody (Biotin)
20-abx337590
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Senp2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6998702 1.0 ug DNA
EUR 154
Senp2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6998703 1.0 ug DNA
EUR 154
Senp2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6998704 1.0 ug DNA
EUR 154
Senp2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4608902 1.0 ug DNA
EUR 154
Senp2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4608903 1.0 ug DNA
EUR 154
Senp2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4608904 1.0 ug DNA
EUR 154
SENP2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2118602 1.0 ug DNA
EUR 154
SENP2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2118603 1.0 ug DNA
EUR 154
SENP2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2118604 1.0 ug DNA
EUR 154
SENP2 Protein Vector (Rat) (pPB-C-His)
PV304082 500 ng
EUR 603
SENP2 Protein Vector (Rat) (pPB-N-His)
PV304083 500 ng
EUR 603
SENP2 Protein Vector (Rat) (pPM-C-HA)
PV304084 500 ng
EUR 603
SENP2 Protein Vector (Rat) (pPM-C-His)
PV304085 500 ng
EUR 603