SCFD2 Antibody
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCFD2. Recognizes SCFD2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
Scfd2 antibody
70R-9215 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal Scfd2 antibody
SCFD2 Antibody
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SCFD2. Recognizes SCFD2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
Scfd2 Blocking Peptide
33R-5541 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Scfd2 antibody, catalog no. 70R-9215
SCFD2 cloning plasmid
CSB-CL840978HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2055
  • Sequence: atgagcgcctcgggcgtactgtcctttacccagcaaggatgggagcaggtgctggccaaagtgaaacgggctgtggtttacctggacgccgcctgcgccgagagcctgcactggggctgcggatccacccgtctcctggaggcggtggggggtcctgactgtcacctgcgagagt
  • Show more
Description: A cloning plasmid for the SCFD2 gene.
SCFD2 Polyclonal Antibody
A60794 100 µg
EUR 570.55
Description: kits suitable for this type of research
anti- SCFD2 antibody
FNab07630 100µg
EUR 548.75
  • Immunogen: sec1 family domain containing 2
  • Uniprot ID: Q8WU76
  • Gene ID: 152579
  • Research Area: Signal Transduction
Description: Antibody raised against SCFD2
Anti-SCFD2 antibody
PAab07630 100 ug
EUR 386
YF-PA22491 50 ug
EUR 363
Description: Mouse polyclonal to Anti-SCFD2
SCFD2 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCFD2. Recognizes SCFD2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SCFD2 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCFD2. Recognizes SCFD2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SCFD2 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCFD2. Recognizes SCFD2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
EF002739 96 Tests
EUR 689
Human SCFD2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse SCFD2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SCFD2 Recombinant Protein (Human)
RP027709 100 ug Ask for price
SCFD2 Recombinant Protein (Rat)
RP227606 100 ug Ask for price
SCFD2 Recombinant Protein (Mouse)
RP170192 100 ug Ask for price
SCFD2 Recombinant Protein (Mouse)
RP170195 100 ug Ask for price
SCFD2 Polyclonal Antibody, Biotin Conjugated
A60795 100 µg
EUR 570.55
Description: fast delivery possible
SCFD2 Polyclonal Antibody, FITC Conjugated
A60796 100 µg
EUR 570.55
Description: reagents widely cited
SCFD2 Polyclonal Antibody, HRP Conjugated
A60797 100 µg
EUR 570.55
Description: Ask the seller for details
Scfd2 ORF Vector (Rat) (pORF)
ORF075870 1.0 ug DNA
EUR 506
SCFD2 ORF Vector (Human) (pORF)
ORF009237 1.0 ug DNA
EUR 95
Scfd2 ORF Vector (Mouse) (pORF)
ORF056732 1.0 ug DNA
EUR 506
Scfd2 ORF Vector (Mouse) (pORF)
ORF056733 1.0 ug DNA
EUR 506
Scfd2 sgRNA CRISPR Lentivector set (Rat)
K6340401 3 x 1.0 ug
EUR 339
Scfd2 sgRNA CRISPR Lentivector set (Mouse)
K3601201 3 x 1.0 ug
EUR 339
SCFD2 sgRNA CRISPR Lentivector set (Human)
K2099501 3 x 1.0 ug
EUR 339
Sec1 Family Domain Containing 2 (SCFD2) Antibody
abx122009-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Sec1 Family Domain Containing 2 (SCFD2) Antibody
abx237630-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
Sec1 Family Domain Containing 2 (SCFD2) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Scfd2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6340402 1.0 ug DNA
EUR 154
Scfd2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6340403 1.0 ug DNA
EUR 154
Scfd2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6340404 1.0 ug DNA
EUR 154
Scfd2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3601202 1.0 ug DNA
EUR 154
Scfd2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3601203 1.0 ug DNA
EUR 154
Scfd2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3601204 1.0 ug DNA
EUR 154
SCFD2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2099502 1.0 ug DNA
EUR 154
SCFD2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2099503 1.0 ug DNA
EUR 154
SCFD2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2099504 1.0 ug DNA
EUR 154
SCFD2 Protein Vector (Rat) (pPB-C-His)
PV303478 500 ng
EUR 1166
SCFD2 Protein Vector (Rat) (pPB-N-His)
PV303479 500 ng
EUR 1166
SCFD2 Protein Vector (Rat) (pPM-C-HA)
PV303480 500 ng
EUR 1166
SCFD2 Protein Vector (Rat) (pPM-C-His)
PV303481 500 ng
EUR 1166
SCFD2 Protein Vector (Mouse) (pPB-C-His)
PV226926 500 ng
EUR 603
SCFD2 Protein Vector (Mouse) (pPB-N-His)
PV226927 500 ng
EUR 603
SCFD2 Protein Vector (Mouse) (pPM-C-HA)
PV226928 500 ng
EUR 603
SCFD2 Protein Vector (Mouse) (pPM-C-His)
PV226929 500 ng
EUR 603
SCFD2 Protein Vector (Mouse) (pPB-C-His)
PV226930 500 ng
EUR 1065
SCFD2 Protein Vector (Mouse) (pPB-N-His)
PV226931 500 ng
EUR 1065
SCFD2 Protein Vector (Mouse) (pPM-C-HA)
PV226932 500 ng
EUR 1065
SCFD2 Protein Vector (Mouse) (pPM-C-His)
PV226933 500 ng
EUR 1065
SCFD2 Protein Vector (Human) (pPB-C-His)
PV036945 500 ng
EUR 329
SCFD2 Protein Vector (Human) (pPB-N-His)
PV036946 500 ng
EUR 329
SCFD2 Protein Vector (Human) (pPM-C-HA)
PV036947 500 ng
EUR 329
SCFD2 Protein Vector (Human) (pPM-C-His)
PV036948 500 ng
EUR 329
Scfd2 3'UTR Luciferase Stable Cell Line
TU118400 1.0 ml Ask for price
Scfd2 3'UTR GFP Stable Cell Line
TU168400 1.0 ml Ask for price
Scfd2 3'UTR Luciferase Stable Cell Line
TU219964 1.0 ml Ask for price
Scfd2 3'UTR GFP Stable Cell Line
TU269964 1.0 ml Ask for price
SCFD2 3'UTR GFP Stable Cell Line
TU072696 1.0 ml
EUR 1394
SCFD2 3'UTR Luciferase Stable Cell Line
TU022696 1.0 ml
EUR 1394
Sec1 Family Domain Containing 2 (SCFD2) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Sec1 Family Domain Containing 2 (SCFD2) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Sec1 Family Domain Containing 2 (SCFD2) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
Human Sec1 family domain- containing protein 2, SCFD2 ELISA KIT
ELI-13435h 96 Tests
EUR 824
Mouse Sec1 family domain- containing protein 2, Scfd2 ELISA KIT
ELI-52383m 96 Tests
EUR 865
Human SEC1 Family Domain Containing Protein 2 (SCFD2) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.
Scfd2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6340405 3 x 1.0 ug
EUR 376
Scfd2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3601205 3 x 1.0 ug
EUR 376
SCFD2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2099505 3 x 1.0 ug
EUR 376
Scfd2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6340406 1.0 ug DNA
EUR 167
Scfd2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6340407 1.0 ug DNA
EUR 167
Scfd2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6340408 1.0 ug DNA
EUR 167
Scfd2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3601206 1.0 ug DNA
EUR 167
Scfd2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3601207 1.0 ug DNA
EUR 167
Scfd2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3601208 1.0 ug DNA
EUR 167
SCFD2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2099506 1.0 ug DNA
EUR 167
SCFD2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2099507 1.0 ug DNA
EUR 167
SCFD2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2099508 1.0 ug DNA
EUR 167