RPL13A

Human Ribosomal Protein L13A (RPL13A) ELISA Kit

DLR-RPL13A-Hu-96T 96T
EUR 725
  • Should the Human Ribosomal Protein L13A (RPL13A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ribosomal Protein L13A (RPL13A) in samples from tissue homogenates or other biological fluids.

Human Ribosomal Protein L13A (RPL13A) ELISA Kit

RDR-RPL13A-Hu-48Tests 48 Tests
EUR 589

Human Ribosomal Protein L13A (RPL13A) ELISA Kit

RDR-RPL13A-Hu-96Tests 96 Tests
EUR 820

Human Ribosomal Protein L13A (RPL13A) ELISA Kit

RD-RPL13A-Hu-48Tests 48 Tests
EUR 563

Human Ribosomal Protein L13A (RPL13A) ELISA Kit

RD-RPL13A-Hu-96Tests 96 Tests
EUR 783

Rpl13a/ Rat Rpl13a ELISA Kit

ELI-38895r 96 Tests
EUR 886

RPL13A antibody

22135-100ul 100ul
EUR 390

RPL13A antibody

70R-12658 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal RPL13A antibody

RPL13A antibody

70R-19965 50 ul
EUR 435
Description: Rabbit polyclonal RPL13A antibody

RPL13A antibody

70R-3024 50 ug
EUR 467
Description: Rabbit polyclonal RPL13A antibody raised against the middle region of RPL13A

RPL13A Antibody

1-CSB-PA05289A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL13A. Recognizes RPL13A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

RPL13A Antibody

DF9126 200ul
EUR 304
Description: RPL13A Antibody detects endogenous levels of total RPL13A.

RPL13A Antibody

1-CSB-PA020130GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPL13A. Recognizes RPL13A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

RPL13A siRNA

20-abx931915
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL13A siRNA

20-abx931916
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RPL13A Antibody

ABD9126 100 ug
EUR 438

pOTB7-RPL13A

PVT18297 2 ug
EUR 231

RPL13A Blocking Peptide

33R-3724 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RPL13A antibody, catalog no. 70R-3024

RPL13A Blocking Peptide

DF9126-BP 1mg
EUR 195

Anti-RPL13A Antibody

A03571-1 100ug/vial
EUR 334

Mouse Rpl13a Antibody

abx030929-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Mouse Rpl13a Antibody

abx030929-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

RPL13A cloning plasmid

CSB-CL020130HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 612
  • Sequence: atggcggaggtgcaggtcctggtgcttgatggtcgaggccatctcctgggccgcctggcggccatcgtggctaaacaggtactgctgggccggaaggtggtggtcgtacgctgtgaaggcatcaacatttctggcaatttctacagaaacaagttgaagtacctggctttcctccg
  • Show more
Description: A cloning plasmid for the RPL13A gene.

RPL13A cloning plasmid

CSB-CL020130HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 612
  • Sequence: atggcggaggtgcaggtcctggtgcttgatggtcgaggccatctcctgggccgcctggcggccatcgtggctaaacaggtactgctgggccggaaggtggtggtcgtacgctgtgaaggcatcaacatttctggcaatttctacagaaacaagttgaagtacctggctttcctccg
  • Show more
Description: A cloning plasmid for the RPL13A gene.

RPL13A cloning plasmid

CSB-CL020130HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 612
  • Sequence: atggcggaggtgcaggtcctggtgcttgatggtcgaggccatctcctgggccgcctggcggccatcgtggctaaacaggtactgctgggccggaaggtggtggtcgtacgctgtgaaggcatcaacatttctggcaatttctacagaaacaagttgaagtacctggctttcctccg
  • Show more
Description: A cloning plasmid for the RPL13A gene.

anti- RPL13A antibody

FNab07413 100µg
EUR 548.75
  • Immunogen: ribosomal protein L13a
  • Uniprot ID: P40429
  • Gene ID: 23521
  • Research Area: Metabolism
Description: Antibody raised against RPL13A

Anti-RPL13A antibody

PAab07413 100 ug
EUR 386

pENTR223-RPL13A vector

PVT11967 2 ug
EUR 308

RPL13A Antibody, HRP conjugated

1-CSB-PA05289B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL13A. Recognizes RPL13A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RPL13A Antibody, FITC conjugated

1-CSB-PA05289C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL13A. Recognizes RPL13A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RPL13A Antibody, Biotin conjugated

1-CSB-PA05289D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RPL13A. Recognizes RPL13A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Canine RPL13A ELISA KIT

ELI-30293d 96 Tests
EUR 928

RPL13A ELISA KIT|Human

EF002570 96 Tests
EUR 689

Mouse RPL13A shRNA Plasmid

20-abx973243
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RPL13A shRNA Plasmid

20-abx958327
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RPL13A Recombinant Protein (Human)

RP026839 100 ug Ask for price

RPL13A Recombinant Protein (Human)

RP026842 100 ug Ask for price

RPL13A Recombinant Protein (Human)

RP026845 100 ug Ask for price

RPL13A Recombinant Protein (Mouse)

RP168968 100 ug Ask for price

RPL13A Recombinant Protein (Rat)

RP226607 100 ug Ask for price

Ribosomal Protein L13A (RPL13A) Antibody

abx218352-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Ribosomal Protein L13A (RPL13A) Antibody

20-abx178278
  • EUR 1316.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Ribosomal Protein L13A (RPL13A) Antibody

20-abx115226
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ribosomal Protein L13A (RPL13A) Antibody

20-abx174420
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Ribosomal Protein L13A (RPL13A) Antibody

abx237413-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Ribosomal Protein L13A (RPL13A) Antibody

20-abx301061
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rpl13a ORF Vector (Rat) (pORF)

ORF075537 1.0 ug DNA
EUR 506

RPL13A ORF Vector (Human) (pORF)

ORF008947 1.0 ug DNA
EUR 95

RPL13A ORF Vector (Human) (pORF)

ORF008948 1.0 ug DNA
EUR 95

RPL13A ORF Vector (Human) (pORF)

ORF008949 1.0 ug DNA
EUR 95

Rpl13a ORF Vector (Mouse) (pORF)

ORF056324 1.0 ug DNA
EUR 506

RPL13A ELISA Kit (Human) (OKCD09456)

OKCD09456 96 Wells
EUR 909
Description: Description of target: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal pro;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.058ng/mL

RPL13A ELISA Kit (Human) (OKDD00510)

OKDD00510 96 Wells
EUR 1053
Description: Description of target: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the L13P family of ribosomal proteins that is a component of the 60S subunit. The encoded protein also plays a role in the repression of inflammatory genes as a component of the IFN-gamma-activated inhibitor of translation (GAIT) complex. This gene is co-transcribed with the small nucleolar RNA genes U32, U33, U34, and U35, which are located in the second, fourth, fifth, and sixth introns, respectively.

As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed throughout the genome. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.058 ng/mL

Ribosomal Protein L13A (RPL13A) Antibody (HRP)

20-abx316095
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ribosomal Protein L13A (RPL13A) Antibody (FITC)

20-abx316096
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ribosomal Protein L13A (RPL13A) Antibody (Biotin)

20-abx316097
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Ribosomal Protein L13A (RPL13A) Protein

20-abx654966
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rpl13a sgRNA CRISPR Lentivector set (Mouse)

K4890501 3 x 1.0 ug
EUR 339

Rpl13a sgRNA CRISPR Lentivector set (Rat)

K7214801 3 x 1.0 ug
EUR 339

RPL13A sgRNA CRISPR Lentivector set (Human)

K1905801 3 x 1.0 ug
EUR 339

Human Ribosomal Protein L13A (RPL13A) ELISA Kit

20-abx152982
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Ribosomal Protein L13A (RPL13A) CLIA Kit

20-abx496185
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rpl13a sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4890502 1.0 ug DNA
EUR 154

Rpl13a sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4890503 1.0 ug DNA
EUR 154

Rpl13a sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4890504 1.0 ug DNA
EUR 154

Rpl13a sgRNA CRISPR Lentivector (Rat) (Target 1)

K7214802 1.0 ug DNA
EUR 154

Rpl13a sgRNA CRISPR Lentivector (Rat) (Target 2)

K7214803 1.0 ug DNA
EUR 154

Rpl13a sgRNA CRISPR Lentivector (Rat) (Target 3)

K7214804 1.0 ug DNA
EUR 154

RPL13A sgRNA CRISPR Lentivector (Human) (Target 1)

K1905802 1.0 ug DNA
EUR 154

RPL13A sgRNA CRISPR Lentivector (Human) (Target 2)

K1905803 1.0 ug DNA
EUR 154

RPL13A sgRNA CRISPR Lentivector (Human) (Target 3)

K1905804 1.0 ug DNA
EUR 154

RPL13A Protein Vector (Rat) (pPB-C-His)

PV302146 500 ng
EUR 603

RPL13A Protein Vector (Rat) (pPB-N-His)

PV302147 500 ng
EUR 603

RPL13A Protein Vector (Rat) (pPM-C-HA)

PV302148 500 ng
EUR 603

RPL13A Protein Vector (Rat) (pPM-C-His)

PV302149 500 ng
EUR 603

RPL13A Protein Vector (Human) (pPB-C-His)

PV035785 500 ng
EUR 329

RPL13A Protein Vector (Human) (pPB-N-His)

PV035786 500 ng
EUR 329

RPL13A Protein Vector (Human) (pPM-C-HA)

PV035787 500 ng
EUR 329

RPL13A Protein Vector (Human) (pPM-C-His)

PV035788 500 ng
EUR 329

RPL13A Protein Vector (Human) (pPB-C-His)

PV035789 500 ng
EUR 329

RPL13A Protein Vector (Human) (pPB-N-His)

PV035790 500 ng
EUR 329

RPL13A Protein Vector (Human) (pPM-C-HA)

PV035791 500 ng
EUR 329

RPL13A Protein Vector (Human) (pPM-C-His)

PV035792 500 ng
EUR 329

RPL13A Protein Vector (Human) (pPB-C-His)

PV035793 500 ng
EUR 329

RPL13A Protein Vector (Human) (pPB-N-His)

PV035794 500 ng
EUR 329