
RNF181 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RNF181 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RNF181 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RNF181 antibody

70R-19924 50 ul
EUR 435
Description: Rabbit polyclonal RNF181 antibody

RNF181 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RNF181. Recognizes RNF181 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

RNF181 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RNF181. Recognizes RNF181 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

anti- RNF181 antibody

FNab07347 100µg
EUR 548.75
  • Immunogen: ring finger protein 181
  • Uniprot ID: Q9P0P0
  • Gene ID: 51255
  • Research Area: Epigenetics, Developmental biology
Description: Antibody raised against RNF181

RNF181 Polyclonal Antibody

A60638 100 µg
EUR 570.55
Description: The best epigenetics products

RNF181 Rabbit pAb

A14405-100ul 100 ul
EUR 308

RNF181 Rabbit pAb

A14405-200ul 200 ul
EUR 459

RNF181 Rabbit pAb

A14405-20ul 20 ul
EUR 183

RNF181 Rabbit pAb

A14405-50ul 50 ul
EUR 223

RNF181 Polyclonal Antibody

28553-100ul 100ul
EUR 252

RNF181 Polyclonal Antibody

28553-50ul 50ul
EUR 187

RNF181 cloning plasmid

CSB-CL882167HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 462
  • Sequence: atggcgtcctatttcgatgaacacgactgcgagccgtcggaccctgagcaggagacgcgaaccaacatgctgctggagctcgcaaggtcacttttcaataggatggactttgaagacttggggttggtagtagattgggaccaccacctgcctccaccagctgccaagactgtggt
  • Show more
Description: A cloning plasmid for the RNF181 gene.

Anti-RNF181 antibody

PAab07347 100 ug
EUR 386

Anti-RNF181 antibody

STJ116616 100 µl
EUR 277

Mouse E3 ubiquitin- protein ligase RNF181, Rnf181 ELISA KIT

ELI-35796m 96 Tests
EUR 865

Bovine E3 ubiquitin- protein ligase RNF181, RNF181 ELISA KIT

ELI-44962b 96 Tests
EUR 928

Human E3 ubiquitin- protein ligase RNF181, RNF181 ELISA KIT

ELI-30246h 96 Tests
EUR 824

RNF181 Polyclonal Conjugated Antibody

C28553 100ul
EUR 397

Mouse RNF181 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat RNF181 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


EF002514 96 Tests
EUR 689

Human RNF181 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RNF181 protein (His tag)

80R-2469 20 ug
EUR 322
Description: Purified recombinant RNF181 protein (His tag)

RNF181 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RNF181. Recognizes RNF181 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RNF181 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RNF181. Recognizes RNF181 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RNF181 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RNF181. Recognizes RNF181 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RNF181 Recombinant Protein (Human)

RP026632 100 ug Ask for price

RNF181 Recombinant Protein (Rat)

RP226373 100 ug Ask for price

RNF181 Recombinant Protein (Mouse)

RP168572 100 ug Ask for price

RNF181 Polyclonal Antibody, Biotin Conjugated

A60639 100 µg
EUR 570.55
Description: kits suitable for this type of research

RNF181 Polyclonal Antibody, FITC Conjugated

A60640 100 µg
EUR 570.55
Description: fast delivery possible

RNF181 Polyclonal Antibody, HRP Conjugated

A60641 100 µg
EUR 570.55
Description: reagents widely cited

RNF181 ORF Vector (Human) (pORF)

ORF008878 1.0 ug DNA
EUR 95

Rnf181 ORF Vector (Mouse) (pORF)

ORF056192 1.0 ug DNA
EUR 506

Rnf181 ORF Vector (Rat) (pORF)

ORF075459 1.0 ug DNA
EUR 506

Ring Finger Protein 181 (RNF181) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Ring Finger Protein 181 (RNF181) Antibody

abx237347-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Ring Finger Protein 181 (RNF181) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RNF181 sgRNA CRISPR Lentivector set (Human)

K1840701 3 x 1.0 ug
EUR 339

Rnf181 sgRNA CRISPR Lentivector set (Mouse)

K4121901 3 x 1.0 ug
EUR 339

Rnf181 sgRNA CRISPR Lentivector set (Rat)

K7487301 3 x 1.0 ug
EUR 339

Ring Finger Protein 181 (RNF181) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ring Finger Protein 181 (RNF181) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ring Finger Protein 181 (RNF181) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RNF181 sgRNA CRISPR Lentivector (Human) (Target 1)

K1840702 1.0 ug DNA
EUR 154

RNF181 sgRNA CRISPR Lentivector (Human) (Target 2)

K1840703 1.0 ug DNA
EUR 154

RNF181 sgRNA CRISPR Lentivector (Human) (Target 3)

K1840704 1.0 ug DNA
EUR 154

Rnf181 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4121902 1.0 ug DNA
EUR 154

Rnf181 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4121903 1.0 ug DNA
EUR 154

Rnf181 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4121904 1.0 ug DNA
EUR 154

Rnf181 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7487302 1.0 ug DNA
EUR 154

Rnf181 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7487303 1.0 ug DNA
EUR 154

Rnf181 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7487304 1.0 ug DNA
EUR 154

RNF181 Protein Vector (Human) (pPB-C-His)

PV035509 500 ng
EUR 329

RNF181 Protein Vector (Human) (pPB-N-His)

PV035510 500 ng
EUR 329

RNF181 Protein Vector (Human) (pPM-C-HA)

PV035511 500 ng
EUR 329

RNF181 Protein Vector (Human) (pPM-C-His)

PV035512 500 ng
EUR 329

Recombinant Human RNF181 Protein, His, E.coli-1mg

QP13329-1mg 1mg
EUR 2757

Recombinant Human RNF181 Protein, His, E.coli-20ug

QP13329-20ug 20ug
EUR 201

Recombinant Human RNF181 Protein, His, E.coli-5ug

QP13329-5ug 5ug
EUR 155

RNF181 Protein Vector (Rat) (pPB-C-His)

PV301834 500 ng
EUR 603

RNF181 Protein Vector (Rat) (pPB-N-His)

PV301835 500 ng
EUR 603

RNF181 Protein Vector (Rat) (pPM-C-HA)

PV301836 500 ng
EUR 603

RNF181 Protein Vector (Rat) (pPM-C-His)

PV301837 500 ng
EUR 603

RNF181 Protein Vector (Mouse) (pPB-C-His)

PV224766 500 ng
EUR 603

RNF181 Protein Vector (Mouse) (pPB-N-His)

PV224767 500 ng
EUR 603

RNF181 Protein Vector (Mouse) (pPM-C-HA)

PV224768 500 ng
EUR 603

RNF181 Protein Vector (Mouse) (pPM-C-His)

PV224769 500 ng
EUR 603

Rnf181 3'UTR GFP Stable Cell Line

TU167981 1.0 ml Ask for price

RNF181 3'UTR Luciferase Stable Cell Line

TU020091 1.0 ml
EUR 1394

Rnf181 3'UTR Luciferase Stable Cell Line

TU117981 1.0 ml Ask for price

RNF181 3'UTR GFP Stable Cell Line

TU070091 1.0 ml
EUR 1394

Rnf181 3'UTR Luciferase Stable Cell Line

TU219533 1.0 ml Ask for price

Rnf181 3'UTR GFP Stable Cell Line

TU269533 1.0 ml Ask for price

Human Ring Finger Protein 181 (RNF181) ELISA Kit

abx382849-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

RNF181 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV664747 1.0 ug DNA
EUR 514

RNF181 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV664751 1.0 ug DNA
EUR 514

RNF181 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV664752 1.0 ug DNA
EUR 514

RNF181 Ring Finger Protein 181 Human Recombinant Protein

PROTQ9P0P0 Regular: 20ug
EUR 317
Description: RNF181 Human Recombinant produced in E. coli is a single polypeptide chain containing 176 amino acids (1-153) and having a molecular mass of 20.3 kDa.;RNF181 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

RNF181 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1840705 3 x 1.0 ug
EUR 376

Rnf181 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4121905 3 x 1.0 ug
EUR 376

Rnf181 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7487305 3 x 1.0 ug
EUR 376