Pank1

PANK1 siRNA

20-abx927678
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PANK1 antibody

22172-100ul 100ul
EUR 390

PANK1 antibody

70R-19105 50 ul
EUR 435
Description: Rabbit polyclonal PANK1 antibody

PANK1 antibody

70R-12945 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal PANK1 antibody

PANK1 Antibody

1-CSB-PA017421GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PANK1. Recognizes PANK1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PANK1 Antibody

1-CSB-PA017421LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PANK1. Recognizes PANK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

anti-PANK1

YF-PA19238 50 ug
EUR 363
Description: Mouse polyclonal to PANK1

anti-PANK1

YF-PA19239 100 ul
EUR 403
Description: Rabbit polyclonal to PANK1

anti-PANK1

YF-PA26230 50 ul
EUR 334
Description: Mouse polyclonal to PANK1

PANK1 cloning plasmid

CSB-CL017421HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 414
  • Sequence: atggcagctaaaggcgacagcaccaatgttgataaactggtgaaggacatttacggaggagactatgaacgatttggccttcaaggatctgctgtagcatcaagctttggcaacatgatgagtaaagaaaagcgagattccatcagcaaggaagacctcgcccgggccacattggt
  • Show more
Description: A cloning plasmid for the PANK1 gene.

anti- PANK1 antibody

FNab06133 100µg
EUR 505.25
  • Immunogen: pantothenate kinase 1
  • Uniprot ID: Q8TE04
  • Gene ID: 53354
  • Research Area: Metabolism
Description: Antibody raised against PANK1

PANK1 Polyclonal Antibody

A60170 100 µg
EUR 570.55
Description: reagents widely cited

PANK1 Rabbit pAb

A4770-100ul 100 ul
EUR 308

PANK1 Rabbit pAb

A4770-200ul 200 ul
EUR 459

PANK1 Rabbit pAb

A4770-20ul 20 ul Ask for price

PANK1 Rabbit pAb

A4770-50ul 50 ul Ask for price

Anti-PANK1 antibody

PAab06133 100 ug
EUR 355

Anti-PANK1 antibody

STJ26854 100 µl
EUR 277
Description: This gene encodes a member of the pantothenate kinase family. Pantothenate kinases are key regulatory enzymes in the biosynthesis of coenzyme A (CoA). The encoded protein catalyzes the first and rate-limiting enzymatic reaction in CoA biosynthesis and is regulated by CoA through feedback inhibition. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. This gene and an intronic miRNA on the same strand are co-regulated by the tumor suppressor p53 (see PMID 20833636).

Polyclonal PANK1 Antibody (Center)

APR08920G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PANK1 (Center). This antibody is tested and proven to work in the following applications:

Mouse PANK1 shRNA Plasmid

20-abx978486
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PANK1 ELISA KIT|Human

EF001545 96 Tests
EUR 689

Human PANK1 shRNA Plasmid

20-abx959968
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PANK1 Antibody, HRP conjugated

1-CSB-PA017421LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PANK1. Recognizes PANK1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PANK1 Antibody, FITC conjugated

1-CSB-PA017421LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PANK1. Recognizes PANK1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PANK1 Antibody, Biotin conjugated

1-CSB-PA017421LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PANK1. Recognizes PANK1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PANK1 Recombinant Protein (Human)

RP022507 100 ug Ask for price

PANK1 Recombinant Protein (Rat)

RP219230 100 ug Ask for price

PANK1 Recombinant Protein (Mouse)

RP160025 100 ug Ask for price

PANK1 Recombinant Protein (Mouse)

RP160028 100 ug Ask for price

Pantothenate Kinase 1 (PANK1) Antibody

20-abx114322
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Pantothenate Kinase 1 (PANK1) Antibody

20-abx131423
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Pantothenate Kinase 1 (PANK1) Antibody

abx033205-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Pantothenate Kinase 1 (PANK1) Antibody

abx033205-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Pantothenate Kinase 1 (PANK1) Antibody

20-abx003607
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Pantothenate Kinase 1 (PANK1) Antibody

abx236133-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Pantothenate Kinase 1 (PANK1) Antibody

20-abx301244
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PANK1 Polyclonal Antibody, Biotin Conjugated

A60171 100 µg
EUR 570.55
Description: Ask the seller for details

PANK1 Polyclonal Antibody, FITC Conjugated

A60172 100 µg
EUR 570.55
Description: The best epigenetics products

PANK1 Polyclonal Antibody, HRP Conjugated

A60173 100 µg
EUR 570.55
Description: kits suitable for this type of research

PANK1 ORF Vector (Human) (pORF)

ORF007503 1.0 ug DNA
EUR 95

Pank1 ORF Vector (Rat) (pORF)

ORF073078 1.0 ug DNA
EUR 506

Pank1 ORF Vector (Mouse) (pORF)

ORF053343 1.0 ug DNA
EUR 506

Pank1 ORF Vector (Mouse) (pORF)

ORF053344 1.0 ug DNA
EUR 506

Recombinant Pantothenate Kinase 1 (PANK1)

4-RPC711Hu01
  • EUR 424.35
  • EUR 216.00
  • EUR 1316.32
  • EUR 505.44
  • EUR 910.88
  • EUR 347.00
  • EUR 3140.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8TE04
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 70.1kDa
  • Isoelectric Point: 5.7
Description: Recombinant Human Pantothenate Kinase 1 expressed in: E.coli

Recombinant Pantothenate Kinase 1 (PANK1)

4-RPC711Mu01
  • EUR 451.23
  • EUR 224.00
  • EUR 1417.12
  • EUR 539.04
  • EUR 978.08
  • EUR 365.00
  • EUR 3392.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8K4K6
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Pantothenate Kinase 1 expressed in: E.coli

Mouse Pantothenate Kinase 1 (PANK1) Protein

20-abx650132
  • EUR 634.00
  • EUR 272.00
  • EUR 1915.00
  • EUR 746.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Pantothenate Kinase 1 (PANK1) Antibody (HRP)

20-abx304735
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pantothenate Kinase 1 (PANK1) Antibody (FITC)

20-abx304736
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Pantothenate Kinase 1 (PANK1) Antibody (Biotin)

20-abx304737
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PANK1 sgRNA CRISPR Lentivector set (Human)

K1591401 3 x 1.0 ug
EUR 339

Pank1 sgRNA CRISPR Lentivector set (Mouse)

K4560001 3 x 1.0 ug
EUR 339

Pank1 sgRNA CRISPR Lentivector set (Rat)

K6756401 3 x 1.0 ug
EUR 339

Human Pantothenate kinase 1, PANK1 ELISA KIT

ELI-12425h 96 Tests
EUR 824

Mouse Pantothenate kinase 1, Pank1 ELISA KIT

ELI-21830m 96 Tests
EUR 865

Human Pantothenate Kinase 1 (PANK1) ELISA Kit

abx382043-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.