NPPA

NPPA siRNA

20-abx926267
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NPPA siRNA

20-abx926268
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NPPA Antibody

ABD6497 100 ug
EUR 438

NPPA Antibody

32338-100ul 100ul
EUR 252

NPPA Antibody

DF6497 200ul
EUR 304
Description: NPPA Antibody detects endogenous levels of total NPPA.

NPPA Antibody

1-CSB-PA908632
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NPPA. Recognizes NPPA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

NPPA Antibody

1-CSB-PA981457
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NPPA. Recognizes NPPA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA;ELISA:1:2000-1:10000

NPPA Antibody

1-CSB-PA578654
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NPPA. Recognizes NPPA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA;ELISA:1:2000-1:10000

NPPA Antibody

1-CSB-PA704716
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NPPA. Recognizes NPPA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

NPPA Antibody

CSB-PA016020KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against NPPA. Recognizes NPPA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

NPPA Antibody

CSB-PA016020KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against NPPA. Recognizes NPPA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

NPPA antibody

PAab09839 100 ug
EUR 386

NPPA Conjugated Antibody

C32338 100ul
EUR 397

NPPA cloning plasmid

CSB-CL016020HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 462
  • Sequence: atgagctccttctccaccaccaccgtgagcttcctccttttactggcattccagctcctaggtcagaccagagctaatcccatgtacaatgccgtgtccaacgcagacctgatggatttcaagaatttgctggaccatttggaagaaaagatgcctttagaagatgaggtcgtgcc
  • Show more
Description: A cloning plasmid for the NPPA gene.

anti- NPPA antibody

FNab09839 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: natriuretic peptide precursor A
  • Uniprot ID: P01160
  • Gene ID: 4878
  • Research Area: Stem Cells, Cardiovascular
Description: Antibody raised against NPPA

NPPA Rabbit pAb

A1609-100ul 100 ul
EUR 308

NPPA Rabbit pAb

A1609-200ul 200 ul
EUR 459

NPPA Rabbit pAb

A1609-20ul 20 ul
EUR 183

NPPA Rabbit pAb

A1609-50ul 50 ul
EUR 223

NPPA Rabbit pAb

A19420-100ul 100 ul Ask for price

NPPA Rabbit pAb

A19420-200ul 200 ul Ask for price

NPPA Rabbit pAb

A19420-20ul 20 ul Ask for price

NPPA Rabbit pAb

A19420-50ul 50 ul
EUR 308

NPPA Rabbit pAb

A14755-100ul 100 ul
EUR 308

NPPA Rabbit pAb

A14755-200ul 200 ul
EUR 459

NPPA Rabbit pAb

A14755-20ul 20 ul
EUR 183

NPPA Rabbit pAb

A14755-50ul 50 ul
EUR 223

NPPA Blocking Peptide

DF6497-BP 1mg
EUR 195

anti- NPPA antibody

LSMab09839 100 ug
EUR 386

Anti-NPPA antibody

STJ11100618 50 µl
EUR 287
Description: The protein encoded by this gene belongs to the natriuretic peptide family. Natriuretic peptides are implicated in the control of extracellular fluid volume and electrolyte homeostasis. This protein is synthesized as a large precursor (containing a signal peptide), which is processed to release a peptide from the N-terminus with similarity to vasoactive peptide, cardiodilatin, and another peptide from the C-terminus with natriuretic-diuretic activity. Mutations in this gene have been associated with atrial fibrillation familial type 6. This gene is located adjacent to another member of the natriuretic family of peptides on chromosome 1.

Anti-NPPA antibody

STJ24798 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the natriuretic peptide family. Natriuretic peptides are implicated in the control of extracellular fluid volume and electrolyte homeostasis. This protein is synthesized as a large precursor (containing a signal peptide), which is processed to release a peptide from the N-terminus with similarity to vasoactive peptide, cardiodilatin, and another peptide from the C-terminus with natriuretic-diuretic activity. Mutations in this gene have been associated with atrial fibrillation familial type 6. This gene is located adjacent to another member of the natriuretic family of peptides on chromosome 1.

Anti-NPPA antibody

STJ116955 100 µl
EUR 277
Description: The protein encoded by this gene belongs to the natriuretic peptide family. Natriuretic peptides are implicated in the control of extracellular fluid volume and electrolyte homeostasis. This protein is synthesized as a large precursor (containing a signal peptide), which is processed to release a peptide from the N-terminus with similarity to vasoactive peptide, cardiodilatin, and another peptide from the C-terminus with natriuretic-diuretic activity. Mutations in this gene have been associated with atrial fibrillation familial type 6. This gene is located adjacent to another member of the natriuretic family of peptides on chromosome 1.

Rat NPPA shRNA Plasmid

20-abx984557
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NPPA ELISA Kit

ELA-E0225h 96 Tests
EUR 824

Human NPPA shRNA Plasmid

20-abx953239
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-ANP/Nppa Antibody

A01318 100ug/vial
EUR 334

Anti-ANP/Nppa Antibody

A01318-1 100ug/vial
EUR 334

Mouse NPPA shRNA Plasmid

20-abx981836
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-ANP/NPPA Antibody

PB9295 100ug/vial
EUR 294

NPPA Recombinant Protein (Human)

RP021565 100 ug Ask for price

NPPA Recombinant Protein (Rat)

RP214361 100 ug Ask for price

NPPA Recombinant Protein (Mouse)

RP154751 100 ug Ask for price

Polyclonal NPPA Antibody (N-term)

APR06090G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NPPA (N-term). This antibody is tested and proven to work in the following applications:

Monoclonal NPPA Antibody, Clone: 1761CT158.12.76

AMM02575G 0.1ml
EUR 484
Description: A Monoclonal antibody against Human NPPA. The antibodies are raised in Mouse and are from clone 1761CT158.12.76. This antibody is applicable in WB, E

Natriuretic Peptides A (NPPA) Antibody

20-abx126985
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Natriuretic Peptides A (NPPA) Antibody

abx117121-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Natriuretic Peptides A (NPPA) Antibody

20-abx001353
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Natriuretic Peptides A (NPPA) Antibody

abx033985-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Natriuretic Peptides A (NPPA) Antibody

abx033985-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

NPPA ORF Vector (Human) (pORF)

ORF007189 1.0 ug DNA
EUR 95

Nppa ORF Vector (Rat) (pORF)

ORF071455 1.0 ug DNA
EUR 506

Nppa ORF Vector (Mouse) (pORF)

ORF051585 1.0 ug DNA
EUR 506

pGL3-Basic-NPPA promoter Plasmid

PVTB00263-4a 2 ug
EUR 356

pECMV-Nppa-m-FLAG Plasmid

PVT14900 2 ug
EUR 325

NPPA ELISA Kit (Mouse) (OKCD01191)

OKCD01191 96 Wells
EUR 779
Description: Description of target: Hormone playing a key role in cardiovascular homeostasis through regulation of natriuresis, diuresis, and vasodilation. Also plays a role in female pregnancy by promoting trophoblast invasion and spiral artery remodeling in uterus. Specifically binds and stimulates the cGMP production of the NPR1 receptor. Binds the clearance receptor NPR3.3 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.6"Blood pressure and fluid-electrolyte balance in mice with reduced or absent ANP."_x005F_x005F_x000D_John S.W., Veress A.T., Honrath U., Chong C.K., Peng L., Smithies O., Sonnenberg H._x005F_x005F_x000D_Am. J. Physiol. 271:R109-R114(1996) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, DISRUPTION PHENOTYPE.Ref.8"Vascular natriuretic peptide receptor-linked particulate guanylate cyclases are modulated by nitric oxide-cyclic GMP signalling."_x005F_x005F_x000D_Madhani M., Scotland R.S., MacAllister R.J., Hobbs A.J._x005F_x005F_x000D_Br. J. Pharmacol. 139:1289-1296(2003) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.11"Role of corin in trophoblast invasion and uterine spiral artery remodelling in pregnancy."_x005F_x005F_x000D_Cui Y., Wang W., Dong N., Lou J., Srinivasan D.K., Cheng W., Huang X., Liu M., Fang C., Peng J., Chen S., Wu S., Liu Z., Dong L., Zhou Y., Wu Q._x005F_x005F_x000D_Nature 484:246-250(2012) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, DISRUPTION PHENOTYPE. ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 29 pg/mL

Nppa ELISA Kit (Mouse) (OKCD01502)

OKCD01502 96 Wells
EUR 779
Description: Description of target: Hormone playing a key role in cardiovascular homeostasis through regulation of natriuresis, diuresis, and vasodilation. Also plays a role in female pregnancy by promoting trophoblast invasion and spiral artery remodeling in uterus. Specifically binds and stimulates the cGMP production of the NPR1 receptor. Binds the clearance receptor NPR3.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 3.0 pg/mL

NPPA ELISA Kit (Human) (OKCD06381)

OKCD06381 96 Wells
EUR 648
Description: Description of target: The protein encoded by this gene belongs to the natriuretic peptide family. Natriuretic peptides are implicated in the control of extracellular fluid volume and electrolyte homeostasis. This protein is synthesized as a large precursor (containing a signal peptide), which is processed to release a peptide from the N-terminus with similarity to vasoactive peptide, cardiodilatin, and another peptide from the C-terminus with natriuretic-diuretic activity. Mutations in this gene have been associated with atrial fibrillation familial type 6. This gene is located adjacent to another member of the natriuretic family of peptides on chromosome 1.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 14pg/mL

NPPA ELISA Kit (Rat) (OKCD06382)

OKCD06382 96 Wells
EUR 818
Description: Description of target: peptide involved in the control of fluid volume and vascular function.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.062ng/mL

NPPA ELISA Kit (Pig) (OKEH03823)

OKEH03823 96 Wells
EUR 779
Description: Description of target: Hormone playing a key role in cardiovascular homeostasis through regulation of natriuresis, diuresis, and vasodilation. Also plays a role in female pregnancy by promoting trophoblast invasion and spiral artery remodeling in uterus. Specifically binds and stimulates the cGMP production of the NPR1 receptor. Binds the clearance receptor NPR3.;Species reactivity: Pig;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 38 pg/mL

NPPA ELISA Kit (Rat) (OKEH04160)

OKEH04160 96 Wells
EUR 662
Description: Description of target: peptide involved in the control of fluid volume and vascular function [RGD, Feb 2006];Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.65 pg/mL

NPPA ELISA Kit (Human) (OKBB01140)

OKBB01140 96 Wells
EUR 505
Description: Description of target: Atrial natriuretic peptide (ANP), also known as NPPA or PND, is a powerful vasodilator, and a protein (polypeptide) hormone secreted by heart muscle cells. This gene is mapped to 1p36.22. It is involved in the homeostatic control of body water, sodium, potassium and fat (adipose tissue). ANP is released by muscle cells in the upper chambers (atria) of the heart (atrial myocytes) in response to high blood volume. It acts to reduce the water, sodium and adipose loads on the circulatory system, thereby reducing blood pressure. ANP has exactly the opposite function of the aldosterone secreted by the zona glomerulosa in regard to its effect on sodium in the kidney – that is, aldosterone stimulates sodium retention and it generates sodium loss.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

NPPA ELISA Kit (Dog) (OKEH07351)

OKEH07351 96 Wells
EUR 1184
Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 10.8pg/mL

NPPA ELISA Kit (Sheep) (OKWB00430)

OKWB00430 96 Wells
EUR 572
Description: Description of target: Hormone playing a key role in cardiovascular homeostasis through regulation of natriuresis, diuresis, and vasodilation. Also plays a role in female pregnancy by promoting trophoblast invasion and spiral artery remodeling in uterus. Specifically binds and stimulates the cGMP production of the NPR1 receptor. Binds the clearance receptor NPR3 ;Species reactivity: Sheep;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 9.4 pg/mL

Polyclonal NPPA / ANP Antibody (C-Terminus)

APG01208G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human NPPA / ANP (C-Terminus). This antibody is tested and proven to work in the following applications:

Natriuretic Peptide Precursor A (NPPA) Antibody

20-abx132148
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Natriuretic Peptide Precursor A (NPPA) Antibody

20-abx132149
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Natriuretic Peptide Precursor A (NPPA) Antibody

20-abx132150
  • EUR 453.00
  • EUR 133.00
  • EUR 1288.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Natriuretic Peptide Precursor A (NPPA) Antibody

20-abx214599
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Natriuretic Peptide Precursor A (NPPA) Antibody

20-abx241129
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Natriuretic Peptide Precursor A (NPPA) Antibody

20-abx241130
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Natriuretic Peptide Precursor A (NPPA) Antibody

20-abx241252
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

NPPA sgRNA CRISPR Lentivector set (Human)

K1449101 3 x 1.0 ug
EUR 339

Nppa sgRNA CRISPR Lentivector set (Mouse)

K4527001 3 x 1.0 ug
EUR 339

Nppa sgRNA CRISPR Lentivector set (Rat)

K7557101 3 x 1.0 ug
EUR 339

NPPA-AS1 ORF Vector (Human) (pORF)

ORF026231 1.0 ug DNA Ask for price

Recombinant Natriuretic Peptide Precursor A (NPPA)

4-RPA275Bo01
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 20.8kDa
  • Isoelectric Point: 5.8
Description: Recombinant Bovine Natriuretic Peptide Precursor A expressed in: E.coli

Recombinant Natriuretic Peptide Precursor A (NPPA)

4-RPA275Hu01
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P01160
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 42.0kDa
  • Isoelectric Point: 5.9
Description: Recombinant Human Natriuretic Peptide Precursor A expressed in: E.coli

Recombinant Natriuretic Peptide Precursor A (NPPA)

4-RPA275Mu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P05125
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 44.1kDa
  • Isoelectric Point: 6.4
Description: Recombinant Mouse Natriuretic Peptide Precursor A expressed in: E.coli

Recombinant Natriuretic Peptide Precursor A (NPPA)

4-RPA275Ra01
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P01161
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 43.9kDa
  • Isoelectric Point: 6.4
Description: Recombinant Rat Natriuretic Peptide Precursor A expressed in: E.coli

Cow Natriuretic Peptides A (NPPA) ELISA Kit

abx512262-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Chicken Natriuretic Peptides A (NPPA) ELISA Kit

abx512263-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Dog Natriuretic Peptides A (NPPA) ELISA Kit

abx512264-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Natriuretic Peptides A (NPPA) ELISA Kit

abx512266-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Pig Natriuretic Peptides A (NPPA) ELISA Kit

abx512267-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Natriuretic Peptides A (NPPA) ELISA Kit

abx512268-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rabbit Natriuretic peptides A (NPPA) ELISA Kit

abx576760-96tests 96 tests
EUR 825
  • Shipped within 1-3 weeks.

Cow Natriuretic Peptide Precursor A (NPPA) Peptide

20-abx652088
  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Natriuretic Peptide Precursor A (NPPA) Peptide

20-abx652089
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Natriuretic Peptide Precursor A (NPPA) Peptide

20-abx652090
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Nppa/ Natriuretic peptides A ELISA Kit

E0686Ra 1 Kit
EUR 571

Human NT-proANP/NPPA PicoKine ELISA Kit

EK1627 96 wells
EUR 425
Description: For Quantitative Detection of human NPPA in cell culture supernates, serum and plasma (heparin, EDTA).

Human NPPA/ Natriuretic peptides A ELISA Kit

E1776Hu 1 Kit
EUR 537

Human Natriuretic Peptides A (NPPA) ELISA Kit

abx253496-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

NPPA sgRNA CRISPR Lentivector (Human) (Target 1)

K1449102 1.0 ug DNA
EUR 154

NPPA sgRNA CRISPR Lentivector (Human) (Target 2)

K1449103 1.0 ug DNA
EUR 154