MUC1

Bovine Mucin 1 (MUC1) ELISA Kit

DLR-MUC1-b-96T 96T
EUR 715
  • Should the Bovine Mucin 1 (MUC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Mucin 1 (MUC1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Mucin 1 (MUC1) ELISA Kit

DLR-MUC1-Hu-48T 48T
EUR 441
  • Should the Human Mucin 1 (MUC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Mucin 1 (MUC1) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Mucin 1 (MUC1) ELISA Kit

DLR-MUC1-Hu-96T 96T
EUR 570
  • Should the Human Mucin 1 (MUC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Mucin 1 (MUC1) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Mucin 1 (MUC1) ELISA Kit

DLR-MUC1-Mu-48T 48T
EUR 489
  • Should the Mouse Mucin 1 (MUC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Mucin 1 (MUC1) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Mucin 1 (MUC1) ELISA Kit

DLR-MUC1-Mu-96T 96T
EUR 635
  • Should the Mouse Mucin 1 (MUC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Mucin 1 (MUC1) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Mucin 1 (MUC1) ELISA Kit

DLR-MUC1-Ra-48T 48T
EUR 508
  • Should the Rat Mucin 1 (MUC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Mucin 1 (MUC1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Mucin 1 (MUC1) ELISA Kit

DLR-MUC1-Ra-96T 96T
EUR 661
  • Should the Rat Mucin 1 (MUC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Mucin 1 (MUC1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Bovine Mucin 1 (MUC1) ELISA Kit

RD-MUC1-b-48Tests 48 Tests
EUR 555

Bovine Mucin 1 (MUC1) ELISA Kit

RD-MUC1-b-96Tests 96 Tests
EUR 771

Human Mucin 1 (MUC1) ELISA Kit

RD-MUC1-Hu-48Tests 48 Tests
EUR 436

Human Mucin 1 (MUC1) ELISA Kit

RD-MUC1-Hu-96Tests 96 Tests
EUR 601

Mouse Mucin 1 (MUC1) ELISA Kit

RD-MUC1-Mu-48Tests 48 Tests
EUR 489

Mouse Mucin 1 (MUC1) ELISA Kit

RD-MUC1-Mu-96Tests 96 Tests
EUR 677

Rat Mucin 1 (MUC1) ELISA Kit

RD-MUC1-Ra-48Tests 48 Tests
EUR 511

Rat Mucin 1 (MUC1) ELISA Kit

RD-MUC1-Ra-96Tests 96 Tests
EUR 709

Bovine Mucin 1 (MUC1) ELISA Kit

RDR-MUC1-b-48Tests 48 Tests
EUR 580

Bovine Mucin 1 (MUC1) ELISA Kit

RDR-MUC1-b-96Tests 96 Tests
EUR 807

Human Mucin 1 (MUC1) ELISA Kit

RDR-MUC1-Hu-48Tests 48 Tests
EUR 455

Human Mucin 1 (MUC1) ELISA Kit

RDR-MUC1-Hu-96Tests 96 Tests
EUR 629

Mouse Mucin 1 (MUC1) ELISA Kit

RDR-MUC1-Mu-48Tests 48 Tests
EUR 511

Mouse Mucin 1 (MUC1) ELISA Kit

RDR-MUC1-Mu-96Tests 96 Tests
EUR 709

Rat Mucin 1 (MUC1) ELISA Kit

RDR-MUC1-Ra-48Tests 48 Tests
EUR 534

Rat Mucin 1 (MUC1) ELISA Kit

RDR-MUC1-Ra-96Tests 96 Tests
EUR 742

MUC1/ Rat MUC1 ELISA Kit

ELA-E0413r 96 Tests
EUR 886

MUC1 Antibody

AF8524 200ul
EUR 376
Description: MUC1 Antibody detects endogenous levels of total MUC1.

MUC1 Antibody

ABF8524 100 ug
EUR 438

MUC1 siRNA

20-abx925018
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MUC1 siRNA

20-abx925019
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MUC1 Antibody

20-abx212765
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

MUC1 Antibody

20-abx212766
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

MUC1 antibody

70R-50091 100 ul
EUR 287
Description: Purified Polyclonal MUC1 antibody

MUC1 antibody

70R-36993 100 ug
EUR 327
Description: Rabbit Polyclonal MUC1 antibody

MUC1 antibody

70R-34542 100 ug
EUR 327
Description: Rabbit polyclonal MUC1 antibody

MUC1 antibody

70R-21468 50 ul
EUR 435
Description: Rabbit polyclonal MUC1 antibody

MUC1 antibody

70R-6603 50 ug
EUR 467
Description: Rabbit polyclonal MUC1 antibody raised against the middle region of MUC1

MUC1 antibody

70R-6968 50 ug
EUR 467
Description: Rabbit polyclonal MUC1 antibody raised against the C terminal of MUC1

MUC1 antibody

70R-7267 50 ug
EUR 467
Description: Rabbit polyclonal MUC1 antibody raised against the middle region of MUC1

MUC1 antibody

70R-7293 50 ug
EUR 467
Description: Rabbit polyclonal MUC1 antibody raised against the N terminal of MUC1

MUC1 antibody

70R-31602 100 ug
EUR 327
Description: Rabbit polyclonal MUC1 antibody

MUC1 Antibody

37857-100ul 100ul
EUR 252

MUC1 Antibody

49024-100ul 100ul
EUR 333

MUC1 Antibody

49024-50ul 50ul
EUR 239

MUC1 antibody

10-M93A 1 mg
EUR 300
Description: Mouse monoclonal MUC1 antibody

MUC1 antibody

10-M93B 1 mg
EUR 295
Description: Mouse monoclonal MUC1 antibody

MUC1 antibody

10R-8091 100 ug
EUR 457
Description: Mouse monoclonal MUC1 antibody

MUC1 antibody

10R-8092 100 ug
EUR 457
Description: Mouse monoclonal MUC1 antibody

MUC1 antibody

10R-8133 100 ug
EUR 457
Description: Mouse monoclonal MUC1 antibody

MUC1 antibody

10R-M129a 200 ug
EUR 489
Description: Mouse monoclonal MUC1 antibody

MUC1 antibody

10R-M129b 100 ug
EUR 553
Description: Hamster monoclonal MUC1 antibody

MUC1 antibody

70R-1744 100 ug
EUR 377
Description: Rabbit polyclonal MUC1 antibody raised against the C terminal of MUC1

MUC1 Antibody

1-CSB-PA941558
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MUC1. Recognizes MUC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

MUC1 Antibody

1-CSB-PA006277
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MUC1. Recognizes MUC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

MUC1 Antibody

1-CSB-PA003334
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MUC1. Recognizes MUC1 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

MUC1 Antibody

1-CSB-PA555678
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MUC1. Recognizes MUC1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

MUC1 Antibody

1-CSB-PA583379
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MUC1. Recognizes MUC1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

MUC1 Antibody

1-CSB-PA692815
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MUC1. Recognizes MUC1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:30-1:150

MUC1 Antibody

1-CSB-PA010276
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MUC1. Recognizes MUC1 from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

MUC1 Antibody

1-CSB-PA010277
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MUC1. Recognizes MUC1 from Human. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

MUC1 Antibody

1-CSB-PA010279
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MUC1. Recognizes MUC1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

MUC1 Antibody

1-CSB-PA141385
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MUC1. Recognizes MUC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

MUC1 Antibody

1-CSB-PA11319A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MUC1. Recognizes MUC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

MUC1 Antibody

1-CSB-PA114224
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MUC1. Recognizes MUC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:300

MUC1 Antibody

1-CSB-PA064912
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MUC1. Recognizes MUC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

MUC1 Antibody

1-CSB-PA015215GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MUC1. Recognizes MUC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

MUC1 Antibody

P1047-01m 0.1m
EUR 194

MUC1 Antibody

P1047-1ml 1ml
EUR 593

anti-MUC1

YF-PA24182 50 ul
EUR 334
Description: Mouse polyclonal to MUC1

MUC1 Blocking Peptide

AF8524-BP 1mg
EUR 195

MUC1 Conjugated Antibody

C37857 100ul
EUR 397

MUC1 Conjugated Antibody

C49024 100ul
EUR 397

Polyclonal MUC1 Antibody

APR06833G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MUC1 . This antibody is tested and proven to work in the following applications:

MUC1 cloning plasmid

CSB-CL015215HU-10ug 10ug
EUR 332
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 795
  • Sequence: ATGACACCGGGCACCCAGTCTCCTTTCTTCCTGCTGCTGCTCCTCACAGTGCTTACAGCTACCACAGCCCCTAAACCCGCAACAGTTGTTACGGGTTCTGGTCATGCAAGCTCTACCCCAGGTGGAGAAAAGGAGACTTCGGCTACCCAGAGAAGTTCAGTGCCCAGCTCTACTGA
  • Show more
Description: A cloning plasmid for the MUC1 gene.

anti- MUC1 antibody

FNab05427 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:5000
  • IP: 1:200-1:2000
  • IHC: 1:20-1:200
  • Immunogen: mucin 1, cell surface associated
  • Uniprot ID: P15941
  • Research Area: Cancer, Immunology
Description: Antibody raised against MUC1

anti- MUC1 antibody

FNab05428 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • Immunogen: mucin 1, cell surface associated
  • Uniprot ID: P15941
  • Research Area: Cancer, Immunology
Description: Antibody raised against MUC1

MUC1 Blocking Peptide

20-abx161955
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

MUC1 Blocking Peptide

20-abx162593
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

MUC1 (pT1229) Antibody

20-abx009832
  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

MUC1 (pY1229) Antibody

abx032050-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

MUC1 (pY1229) Antibody

abx032050-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

MUC1 (pT1224) Antibody

abx032089-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

MUC1 (pT1224) Antibody

abx032089-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

MUC1 (pS1227) Antibody

abx216974-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

MUC1 (pY1229) Antibody

abx332886-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

Anti-MUC1 Antibody

A00187 100ug/vial
EUR 334

MUC1 Rabbit pAb

A0333-100ul 100 ul
EUR 308

MUC1 Rabbit pAb

A0333-200ul 200 ul
EUR 459

MUC1 Rabbit pAb

A0333-20ul 20 ul
EUR 183

MUC1 Rabbit pAb

A0333-50ul 50 ul
EUR 223

MUC1 Antibody (EP1024Y)

A1009-100
EUR 338

MUC1 Polyclonal Antibody

A52829 100 µg
EUR 570.55
Description: kits suitable for this type of research

MUC1 antibody (Tyr1229)

70R-36157 100 ug
EUR 327
Description: Rabbit polyclonal MUC1 antibody (Tyr1229)

MUC1 Rabbit mAb

A19081-100ul 100 ul
EUR 410

MUC1 Rabbit mAb

A19081-200ul 200 ul
EUR 571

MUC1 Rabbit mAb

A19081-20ul 20 ul
EUR 221

MUC1 Rabbit mAb

A19081-50ul 50 ul
EUR 287