msc cells


EUR 153


EUR 457

MSC Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MSC. Recognizes MSC from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Musculin (MSC) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Musculin (MSC) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Musculin (MSC) Antibody

abx029864-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Musculin (MSC) Antibody

abx029864-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Musculin (MSC) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Musculin (MSC) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

MSC cloning plasmid

CSB-CL015025HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 621
  • Sequence: atgtccacgggctcggtgagtgatccggaggagatggagcttcgggggctgcagcgggagtacccggtccccgcctccaagaggccgcccctccgcggcgtagagcgcagctacgcctcgcccagtgacaactcgtcggcagaggaggaggaccccgacggcgaggaggagcgctg
  • Show more
Description: A cloning plasmid for the MSC gene.

pDONR223-MSC Plasmid

PVTB01127-1 2 ug
EUR 356


PVT17279 2 ug
EUR 474

Anti-MSC (1D1)

YF-MA16741 100 ug
EUR 363
Description: Mouse monoclonal to MSC

Anti-MSC (4D7)

YF-MA16742 100 ug
EUR 363
Description: Mouse monoclonal to MSC

MSC Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MSC. Recognizes MSC from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MSC Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MSC. Recognizes MSC from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MSC Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MSC. Recognizes MSC from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA


EF005304 96 Tests
EUR 689

Mouse MSC shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Musculin (MSC) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Musculin (MSC) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Musculin (MSC) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human MSC shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MSC Recombinant Protein (Human)

RP020146 100 ug Ask for price

MSC Recombinant Protein (Mouse)

RP151784 100 ug Ask for price

MSC Recombinant Protein (Rat)

RP212531 100 ug Ask for price

Anti-MSC / ABF1 antibody

STJ70022 100 µg
EUR 359

Mouse Musculin, Msc ELISA KIT

ELI-22864m 96 Tests
EUR 865

Human Musculin, MSC ELISA KIT

ELI-42338h 96 Tests
EUR 824

Human Musculin (MSC) ELISA Kit

abx385179-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Musculin (MSC) ELISA Kit

abx389942-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Msc ORF Vector (Rat) (pORF)

ORF070845 1.0 ug DNA
EUR 506

MSC ORF Vector (Human) (pORF)

ORF006716 1.0 ug DNA
EUR 95

Msc ORF Vector (Mouse) (pORF)

ORF050596 1.0 ug DNA
EUR 506

Human Musculin(MSC)ELISA Kit  

QY-E03076 96T
EUR 361

Goat Anti Human Msc Polyclonal Antibody

DPBT-67363GH 0.1 mg
EUR 861

Msc sgRNA CRISPR Lentivector set (Rat)

K6197201 3 x 1.0 ug
EUR 339

Msc sgRNA CRISPR Lentivector set (Mouse)

K4473001 3 x 1.0 ug
EUR 339

MSC sgRNA CRISPR Lentivector set (Human)

K1348001 3 x 1.0 ug
EUR 339

Msc ELISA Kit| Mouse Musculin ELISA Kit

EF015581 96 Tests
EUR 689

Msc sgRNA CRISPR Lentivector (Rat) (Target 1)

K6197202 1.0 ug DNA
EUR 154

Msc sgRNA CRISPR Lentivector (Rat) (Target 2)

K6197203 1.0 ug DNA
EUR 154

Msc sgRNA CRISPR Lentivector (Rat) (Target 3)

K6197204 1.0 ug DNA
EUR 154

Msc sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4473002 1.0 ug DNA
EUR 154

Msc sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4473003 1.0 ug DNA
EUR 154

Msc sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4473004 1.0 ug DNA
EUR 154

MSC sgRNA CRISPR Lentivector (Human) (Target 1)

K1348002 1.0 ug DNA
EUR 154

MSC sgRNA CRISPR Lentivector (Human) (Target 2)

K1348003 1.0 ug DNA
EUR 154

MSC sgRNA CRISPR Lentivector (Human) (Target 3)

K1348004 1.0 ug DNA
EUR 154

MSC Protein Vector (Mouse) (pPB-C-His)

PV202382 500 ng
EUR 603

MSC Protein Vector (Mouse) (pPB-N-His)

PV202383 500 ng
EUR 603

MSC Protein Vector (Mouse) (pPM-C-HA)

PV202384 500 ng
EUR 603

MSC Protein Vector (Mouse) (pPM-C-His)

PV202385 500 ng
EUR 603

MSC Protein Vector (Rat) (pPB-C-His)

PV283378 500 ng
EUR 603

MSC Protein Vector (Rat) (pPB-N-His)

PV283379 500 ng
EUR 603

MSC Protein Vector (Rat) (pPM-C-HA)

PV283380 500 ng
EUR 603

MSC Protein Vector (Rat) (pPM-C-His)

PV283381 500 ng
EUR 603

MSC Protein Vector (Human) (pPB-C-His)

PV026861 500 ng
EUR 329

MSC Protein Vector (Human) (pPB-N-His)

PV026862 500 ng
EUR 329

MSC Protein Vector (Human) (pPM-C-HA)

PV026863 500 ng
EUR 329

MSC Protein Vector (Human) (pPM-C-His)

PV026864 500 ng
EUR 329

Msc 3'UTR Luciferase Stable Cell Line

TU113512 1.0 ml Ask for price

Msc 3'UTR GFP Stable Cell Line

TU163512 1.0 ml Ask for price

Msc 3'UTR Luciferase Stable Cell Line

TU213475 1.0 ml Ask for price

Msc 3'UTR GFP Stable Cell Line

TU263475 1.0 ml Ask for price

MSC 3'UTR GFP Stable Cell Line

TU064752 1.0 ml
EUR 1394

MSC 3'UTR Luciferase Stable Cell Line

TU014752 1.0 ml
EUR 1394

Dendritic Cells/B Cells Antibody

abx412775-02mg 0.2 mg
EUR 565
  • Shipped within 1 week.

anti-CD45 RA B-cells, T-cells, NK-cells

516-A-01mg 0,1 mg
EUR 267.5
  • Category: Antibody, Signal Transduction Antibodies, mAb
Description: anti-CD45 RA B-cells, T-cells, NK-cells

anti-CD45 RA B-cells, T-cells, NK-cells

516-A-1000ug 1000 ug
EUR 1282.5
  • Category: Antibody, Signal Transduction Antibodies, mAb
Description: anti-CD45 RA B-cells, T-cells, NK-cells

5637 cells

C0002001 One Frozen vial
EUR 485

MB49 cells

C0002004 One Frozen vial
EUR 777

K562 cells

C0003004 One Frozen vial
EUR 455

U937 cells

C0003005 One Frozen vial
EUR 455

Raji cells

C0003009 One Frozen vial
EUR 455

Daudi cells

C0003010 One Frozen vial
EUR 455

RS4;11 cells

C0003012 One Frozen vial
EUR 455


C0003013 One Frozen vial
EUR 455

BJAB cells

C0003016 One Frozen vial
EUR 543

FO cells

C0003017 One Frozen vial
EUR 485

MC116 cells

C0003021 One Frozen vial
EUR 485

P3X63Ag8.653 cells

C0003028 One Frozen vial
EUR 455

REH cells

C0003031 One Frozen vial
EUR 485

Mino cells

C0003033 One Frozen vial
EUR 485

U87MG cells

C0005002 One Frozen vial
EUR 455

B103 cells

C0005003 One Frozen vial
EUR 777

T47D cells

C0006001 One Frozen vial
EUR 455

4T1 cells

C0006004 One Frozen vial
EUR 455

HeLa cells

C0008001 One Frozen vial
EUR 455

SiHa cells

C0008002 One Frozen vial
EUR 455

C33A cells

C0008003 One Frozen vial
EUR 455

CaSKi cells

C0008004 One Frozen vial
EUR 455

SW480 cells

C0009001 One Frozen vial
EUR 455