GORASP1 Antibody

ABD9536 100 ug
EUR 438


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GORASP1 antibody

70R-3717 50 ug
EUR 467
Description: Rabbit polyclonal GORASP1 antibody raised against the N terminal of GORASP1

GORASP1 antibody

70R-9520 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal GORASP1 antibody

GORASP1 antibody

39041-100ul 100ul
EUR 252

GORASP1 antibody

10R-4226 100 ul
EUR 691
Description: Mouse monoclonal GORASP1 antibody

GORASP1 antibody

10R-4227 100 ul
EUR 691
Description: Mouse monoclonal GORASP1 antibody

GORASP1 Antibody

DF9536 200ul
EUR 304
Description: GORASP1 Antibody detects endogenous levels of total GORASP1.

GORASP1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GORASP1. Recognizes GORASP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GORASP1 Conjugated Antibody

C39041 100ul
EUR 397

GORASP1 Rabbit pAb

A6609-100ul 100 ul
EUR 308

GORASP1 Rabbit pAb

A6609-200ul 200 ul
EUR 459

GORASP1 Rabbit pAb

A6609-20ul 20 ul
EUR 183

GORASP1 Rabbit pAb

A6609-50ul 50 ul
EUR 223

GORASP1 Blocking Peptide

33R-6044 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GORASP1 antibody, catalog no. 70R-9520

GORASP1 Blocking Peptide

33R-7444 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GORASP1 antibody, catalog no. 70R-3717

GORASP1 cloning plasmid

CSB-CL861116HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 648
  • Sequence: atgggcctgggcgtcagcgctgagcagcccgcaggcggcgccgagggcttccacctccacggggtgcaggagaactccccagcccagcaggcgggcctggagccctactttgacttcatcatcaccattgggcactcgaggctgaacaaggagaatgacaccctgaaggcactact
  • Show more
Description: A cloning plasmid for the GORASP1 gene.

GORASP1 cloning plasmid

CSB-CL861116HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1323
  • Sequence: atgggcctgggcgtcagcgctgagcagcccgcaggcggcgccgagggcttccacctccacggggtgcaggagaactccccagcccagcaggcgggcctggagccctactttgacttcatcatcaccattgggcactcgaggctgaacaaggagaatgacaccctgaaggcactac
  • Show more
Description: A cloning plasmid for the GORASP1 gene.

GORASP1 Blocking Peptide

DF9536-BP 1mg
EUR 195

Anti-GORASP1 antibody

STJ28692 100 µl
EUR 277
Description: The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is a membrane protein involved in establishing the stacked structure of the Golgi apparatus. It is a caspase-3 substrate, and cleavage of this encoded protein contributes to Golgi fragmentation in apoptosis. This encoded protein can form a complex with the Golgi matrix protein GOLGA2, and this complex binds to the vesicle docking protein p115. Alternative splicing results in multiple transcript variants of this gene.

Mouse GORASP1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

anti- GRASP65,GORASP1 antibody

FNab03636 100µg
EUR 505.25
  • Immunogen: golgi reassembly stacking protein 1, 65kDa
  • Uniprot ID: Q9BQQ3
  • Research Area: Cell Division and Proliferation
Description: Antibody raised against GRASP65,GORASP1

Human GORASP1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-GRASP65,GORASP1 antibody

PAab03636 100 ug
EUR 355

GORASP1 Recombinant Protein (Human)

RP013654 100 ug Ask for price

GORASP1 Recombinant Protein (Human)

RP013657 100 ug Ask for price

GORASP1 Recombinant Protein (Rat)

RP203129 100 ug Ask for price

GORASP1 Recombinant Protein (Mouse)

RP139178 100 ug Ask for price


EF009987 96 Tests
EUR 689

GORASP1 ORF Vector (Human) (pORF)

ORF004552 1.0 ug DNA
EUR 95

GORASP1 ORF Vector (Human) (pORF)

ORF004553 1.0 ug DNA
EUR 95

Gorasp1 ORF Vector (Rat) (pORF)

ORF067711 1.0 ug DNA
EUR 506

Gorasp1 ORF Vector (Mouse) (pORF)

ORF046394 1.0 ug DNA
EUR 506

GORASP1 sgRNA CRISPR Lentivector set (Human)

K0883701 3 x 1.0 ug
EUR 339

Gorasp1 sgRNA CRISPR Lentivector set (Mouse)

K3233901 3 x 1.0 ug
EUR 339

Gorasp1 sgRNA CRISPR Lentivector set (Rat)

K7547901 3 x 1.0 ug
EUR 339

GORASP1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0883702 1.0 ug DNA
EUR 154

GORASP1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0883703 1.0 ug DNA
EUR 154

GORASP1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0883704 1.0 ug DNA
EUR 154

Gorasp1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3233902 1.0 ug DNA
EUR 154

Gorasp1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3233903 1.0 ug DNA
EUR 154

Gorasp1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3233904 1.0 ug DNA
EUR 154

Gorasp1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7547902 1.0 ug DNA
EUR 154

Gorasp1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7547903 1.0 ug DNA
EUR 154

Gorasp1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7547904 1.0 ug DNA
EUR 154

GORASP1 Protein Vector (Mouse) (pPB-C-His)

PV185574 500 ng
EUR 603

GORASP1 Protein Vector (Mouse) (pPB-N-His)

PV185575 500 ng
EUR 603

GORASP1 Protein Vector (Mouse) (pPM-C-HA)

PV185576 500 ng
EUR 603

GORASP1 Protein Vector (Mouse) (pPM-C-His)

PV185577 500 ng
EUR 603

GORASP1 Protein Vector (Rat) (pPB-C-His)

PV270842 500 ng
EUR 603

GORASP1 Protein Vector (Rat) (pPB-N-His)

PV270843 500 ng
EUR 603

GORASP1 Protein Vector (Rat) (pPM-C-HA)

PV270844 500 ng
EUR 603

GORASP1 Protein Vector (Rat) (pPM-C-His)

PV270845 500 ng
EUR 603

GORASP1 Protein Vector (Human) (pPB-C-His)

PV018205 500 ng
EUR 329

GORASP1 Protein Vector (Human) (pPB-N-His)

PV018206 500 ng
EUR 329

GORASP1 Protein Vector (Human) (pPM-C-HA)

PV018207 500 ng
EUR 329

GORASP1 Protein Vector (Human) (pPM-C-His)

PV018208 500 ng
EUR 329

GORASP1 Protein Vector (Human) (pPB-C-His)

PV018209 500 ng
EUR 329

GORASP1 Protein Vector (Human) (pPB-N-His)

PV018210 500 ng
EUR 329