GNB4 antibody

70R-17529 50 ul
EUR 435
Description: Rabbit polyclonal GNB4 antibody

GNB4 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNB4. Recognizes GNB4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

GNB4 antibody

70R-9512 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal GNB4 antibody

GNB4 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GNB4. Recognizes GNB4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNB4 Polyclonal Antibody

27771-100ul 100ul
EUR 252

GNB4 Polyclonal Antibody

27771-50ul 50ul
EUR 187

GNB4 Rabbit pAb

A12731-100ul 100 ul
EUR 308

GNB4 Rabbit pAb

A12731-200ul 200 ul
EUR 459

GNB4 Rabbit pAb

A12731-20ul 20 ul
EUR 183

GNB4 Rabbit pAb

A12731-50ul 50 ul
EUR 223

GNB4 Blocking Peptide

33R-1960 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNB4 antibody, catalog no. 70R-9512

GNB3 & GNB4 Antibody

abx432048-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

GNB3 & GNB4 Antibody

abx433482-100ug 100 ug
EUR 453
  • Shipped within 1-3 working days.

GNB4 cloning plasmid

CSB-CL862056HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1023
  • Sequence: atgagcgaactggaacagttgaggcaagaagcagaacaactgcggaatcagattcaggatgctcggaaagcatgtaatgatgcaacgcttgttcagattacatcaaatatggactccgtgggtcgaatacaaatgcgaacaagacgtacactgaggggccacctagctaaaatct
  • Show more
Description: A cloning plasmid for the GNB4 gene.

GNB4 Rabbit pAb

A8774-100ul 100 ul
EUR 308

GNB4 Rabbit pAb

A8774-200ul 200 ul
EUR 459

GNB4 Rabbit pAb

A8774-20ul 20 ul Ask for price

GNB4 Rabbit pAb

A8774-50ul 50 ul Ask for price

anti- GNB4 antibody

FNab03542 100µg
EUR 548.75
  • Immunogen: guanine nucleotide binding protein(G protein), beta polypeptide 4
  • Uniprot ID: Q9HAV0
  • Gene ID: 59345
  • Research Area: Signal Transduction
Description: Antibody raised against GNB4

Anti-GNB4 antibody

PAab03542 100 ug
EUR 386


PVT12823 2 ug
EUR 391

Anti-GNB4 antibody

STJ111411 100 µl
EUR 277
Description: Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors.

Anti-GNB4 antibody

STJ114604 100 µl
EUR 277
Description: Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors.

GNB4 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNB4. Recognizes GNB4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNB4 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNB4. Recognizes GNB4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNB4 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNB4. Recognizes GNB4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA


EF009914 96 Tests
EUR 689

Rat GNB4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GNB4 Polyclonal Conjugated Antibody

C27771 100ul
EUR 397

Polyclonal GNB4 Antibody (Center)

AMM04831G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNB4 (Center). This antibody is tested and proven to work in the following applications:

Human GNB4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GNB4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Gnb4 ELISA KIT

ELI-48620m 96 Tests
EUR 865


ELI-37684h 96 Tests
EUR 824

GNB4 Recombinant Protein (Human)

RP013525 100 ug Ask for price

GNB4 Recombinant Protein (Rat)

RP203000 100 ug Ask for price

GNB4 Recombinant Protein (Mouse)

RP138980 100 ug Ask for price

Anti-GNB3 & GNB4 antibody

STJ72402 100 µg
EUR 359

Gnb4 ORF Vector (Rat) (pORF)

ORF067668 1.0 ug DNA
EUR 506

GNB4 ORF Vector (Human) (pORF)

ORF004509 1.0 ug DNA
EUR 95

Gnb4 ORF Vector (Mouse) (pORF)

ORF046328 1.0 ug DNA
EUR 506

Anti-GNB3 & GNB4, Biotinylated antibody

STJ73503 100 µg
EUR 359

Polyclonal GNB3 & GNB4 Antibody (internal region)

AMM04829G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human GNB3 & GNB4 (internal region). This antibody is tested and proven to work in the following applications:

Gnb4 sgRNA CRISPR Lentivector set (Mouse)

K4873601 3 x 1.0 ug
EUR 339

Gnb4 sgRNA CRISPR Lentivector set (Rat)

K6430601 3 x 1.0 ug
EUR 339

GNB4 sgRNA CRISPR Lentivector set (Human)

K0876301 3 x 1.0 ug
EUR 339

Gnb4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4873602 1.0 ug DNA
EUR 154

Gnb4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4873603 1.0 ug DNA
EUR 154

Gnb4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4873604 1.0 ug DNA
EUR 154

Gnb4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6430602 1.0 ug DNA
EUR 154

Gnb4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6430603 1.0 ug DNA
EUR 154

Gnb4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6430604 1.0 ug DNA
EUR 154

GNB4 sgRNA CRISPR Lentivector (Human) (Target 1)

K0876302 1.0 ug DNA
EUR 154

GNB4 sgRNA CRISPR Lentivector (Human) (Target 2)

K0876303 1.0 ug DNA
EUR 154

GNB4 sgRNA CRISPR Lentivector (Human) (Target 3)

K0876304 1.0 ug DNA
EUR 154

GNB4 Protein Vector (Rat) (pPB-C-His)

PV270670 500 ng
EUR 603

GNB4 Protein Vector (Rat) (pPB-N-His)

PV270671 500 ng
EUR 603