FN3K

Human Fructosamine-3-Kinase (FN3K) ELISA Kit

DLR-FN3K-Hu-96T 96T
EUR 673
  • Should the Human Fructosamine-3-Kinase (FN3K) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fructosamine-3-Kinase (FN3K) in samples from plasma, tissue homogenates, cell lysates or other biological fluids.

Human Fructosamine-3-Kinase (FN3K) ELISA Kit

RDR-FN3K-Hu-48Tests 48 Tests
EUR 544

Human Fructosamine-3-Kinase (FN3K) ELISA Kit

RDR-FN3K-Hu-96Tests 96 Tests
EUR 756

Human Fructosamine-3-Kinase (FN3K) ELISA Kit

RD-FN3K-Hu-48Tests 48 Tests
EUR 521

Human Fructosamine-3-Kinase (FN3K) ELISA Kit

RD-FN3K-Hu-96Tests 96 Tests
EUR 723

FN3K antibody

70R-17336 50 ul
EUR 435
Description: Rabbit polyclonal FN3K antibody

FN3K Antibody

44782-100ul 100ul
EUR 252

FN3K Antibody

44782-50ul 50ul
EUR 187

FN3K Antibody

DF2468 200ul
EUR 304
Description: FN3K antibody detects endogenous levels of total FN3K.

FN3K Antibody

1-CSB-PA008760GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against FN3K. Recognizes FN3K from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

FN3K siRNA

20-abx917026
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FN3K siRNA

20-abx917027
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FN3K Antibody

ABD2468 100 ug
EUR 438

anti-FN3K

YF-PA20456 50 ul
EUR 363
Description: Mouse polyclonal to FN3K

anti-FN3K

YF-PA20457 100 ul
EUR 403
Description: Rabbit polyclonal to FN3K

anti-FN3K

YF-PA20458 100 ug
EUR 403
Description: Rabbit polyclonal to FN3K

FN3K Rabbit pAb

A13727-100ul 100 ul
EUR 308

FN3K Rabbit pAb

A13727-200ul 200 ul
EUR 459

FN3K Rabbit pAb

A13727-20ul 20 ul
EUR 183

FN3K Rabbit pAb

A13727-50ul 50 ul
EUR 223

FN3K Blocking Peptide

DF2468-BP 1mg
EUR 195

FN3K Conjugated Antibody

C44782 100ul
EUR 397

FN3K cloning plasmid

CSB-CL872493HU-10ug 10ug
EUR 370
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 930
  • Sequence: atggagcagctgctgcgcgccgagctgcgcaccgcgaccctgcgggccttcggcggccccggcgccggctgcatcagcgagggccgagcctacgacacggacgcaggcccagtgttcgtcaaagtcaaccgcaggacgcaggcccggcagatgtttgagggggaggtggccagcct
  • Show more
Description: A cloning plasmid for the FN3K gene.

FN3K Polyclonal Antibody

ABP58578-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human FN3K protein at amino acid sequence of 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of FN3K from Human, Mouse. This FN3K antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FN3K protein at amino acid sequence of 130-210

FN3K Polyclonal Antibody

ABP58578-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human FN3K protein at amino acid sequence of 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of FN3K from Human, Mouse. This FN3K antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FN3K protein at amino acid sequence of 130-210

FN3K Polyclonal Antibody

ABP58578-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human FN3K protein at amino acid sequence of 130-210
  • Applications tips:
Description: A polyclonal antibody for detection of FN3K from Human, Mouse. This FN3K antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human FN3K protein at amino acid sequence of 130-210

FN3K Polyclonal Antibody

ES10651-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against FN3K from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

FN3K Polyclonal Antibody

ES10651-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against FN3K from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- FN3K antibody

FNab03174 100µg
EUR 585
  • Immunogen: fructosamine 3 kinase
  • Uniprot ID: Q9H479
  • Gene ID: 64122
  • Research Area: Metabolism
Description: Antibody raised against FN3K

Anti-FN3K antibody

PAab03174 100 ug
EUR 412

Anti-FN3K antibody

STJ115680 100 µl
EUR 277
Description: A high concentration of glucose can result in non-enzymatic oxidation of proteins by reaction of glucose and lysine residues (glycation). Proteins modified in this way, fructosamines, are less active or functional. This gene encodes an enzyme which catalyzes the phosphorylation of fructosamines which may result in deglycation.

Anti-FN3K antibody

STJ191809 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to FN3K

Anti-FN3K (4F2)

YF-MA19204 100 ug
EUR 363
Description: Mouse monoclonal to FN3K

FN3K protein (His tag)

30R-2948 50 ug
EUR 322
Description: Purified recombinant Human FN3K protein (His tag)

Human FN3K-RP Antibody

33415-05111 150 ug
EUR 261

FN3K ELISA KIT|Human

EF009661 96 Tests
EUR 689

Mouse FN3K shRNA Plasmid

20-abx975229
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human FN3K shRNA Plasmid

20-abx961933
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FN3K Recombinant Protein (Human)

RP012400 100 ug Ask for price

FN3K Recombinant Protein (Rat)

RP201593 100 ug Ask for price

FN3K Recombinant Protein (Mouse)

RP134894 100 ug Ask for price

FN3K Recombinant Protein (Mouse)

RP134897 100 ug Ask for price

Fructosamine-3-Kinase (FN3K) Antibody

20-abx116834
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fructosamine-3-Kinase (FN3K) Antibody

20-abx124749
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Fructosamine-3-Kinase (FN3K) Antibody

20-abx129034
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fructosamine-3-Kinase (FN3K) Antibody

abx122503-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Fructosamine-3-Kinase (FN3K) Antibody

20-abx147674
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Fructosamine-3-Kinase (FN3K) Antibody

20-abx172478
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Fructosamine-3-Kinase (FN3K) Antibody

abx034793-100ul 100 ul
EUR 523
  • Shipped within 5-10 working days.

Fructosamine-3-Kinase (FN3K) Antibody

abx233174-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Fn3k ORF Vector (Rat) (pORF)

ORF067199 1.0 ug DNA
EUR 506

FN3K ORF Vector (Human) (pORF)

ORF004134 1.0 ug DNA
EUR 95

Fn3k ORF Vector (Mouse) (pORF)

ORF044966 1.0 ug DNA
EUR 506

Fn3k ORF Vector (Mouse) (pORF)

ORF044967 1.0 ug DNA
EUR 506

Recombinant Fructosamine-3-Kinase (FN3K)

4-RPJ094Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9H479
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 38.9kDa
  • Isoelectric Point: 7.1
Description: Recombinant Human Fructosamine-3-Kinase expressed in: E.coli

FN3K ELISA Kit (Human) (OKCD01046)

OKCD01046 96 Wells
EUR 831
Description: Description of target: May initiate a process leading to the deglycation of fructoselysine and of glycated proteins. May play a role in the phosphorylation of 1-deoxy-1-morpholinofructose (DMF), fructoselysine, fructoseglycine, fructose and glycated lysozyme. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.114 ng/mL

FN3K ELISA Kit (Mouse) (OKCA01668)

OKCA01668 96 Wells
EUR 846
Description: Description of target: May initiate a process leading to the deglycation of fructoselysine and of glycated proteins. May play a role in the phosphorylation of 1-deoxy-1-morpholinofructose (DMF), fructoselysine, fructoseglycine, fructose and glycated lysozyme.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 15.6 pg/mL

FN3K ELISA Kit (Human) (OKDD00271)

OKDD00271 96 Wells
EUR 975
Description: Description of target: A high concentration of glucose can result in non-enzymatic oxidation of proteins by reaction of glucose and lysine residues (glycation). Proteins modified in this way, fructosamines, are less active or functional. This gene encodes an enzyme which catalyzes the phosphorylation of fructosamines which may result in deglycation.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.071 ng/mL

Human FN3K-RP Antibody (Biotin Conjugate)

33415-05121 150 ug
EUR 369

Human Fructosamine-3-Kinase (FN3K) Protein

20-abx166574
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fructosamine-3-Kinase (FN3K) Antibody (Biotin)

20-abx274324
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Fn3k sgRNA CRISPR Lentivector set (Rat)

K6161201 3 x 1.0 ug
EUR 339

FN3K sgRNA CRISPR Lentivector set (Human)

K0791101 3 x 1.0 ug
EUR 339

Fn3k sgRNA CRISPR Lentivector set (Mouse)

K3534401 3 x 1.0 ug
EUR 339

Human FN3K-RP AssayLite Antibody (FITC Conjugate)

33415-05141 150 ug
EUR 428

Human FN3K-RP AssayLite Antibody (RPE Conjugate)

33415-05151 150 ug
EUR 428

Human FN3K-RP AssayLite Antibody (APC Conjugate)

33415-05161 150 ug
EUR 428

Human FN3K-RP AssayLite Antibody (PerCP Conjugate)

33415-05171 150 ug
EUR 471

Human Fructosamine 3 Kinase (FN3K) ELISA Kit

20-abx151588
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Fructosamine- 3- kinase, Fn3k ELISA KIT

ELI-07786m 96 Tests
EUR 865