Cx3Cr1

Human Chemokine C-X3-C-Motif Receptor 1 (CX3CR1) ELISA Kit

DLR-CX3CR1-Hu-96T 96T
EUR 647
  • Should the Human Chemokine C-X3-C-Motif Receptor 1 (CX3CR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Chemokine C-X3-C-Motif Receptor 1 (CX3CR1) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Chemokine C-X3-C-Motif Receptor 1 (CX3CR1) ELISA Kit

DLR-CX3CR1-Mu-48T 48T
EUR 508
  • Should the Mouse Chemokine C-X3-C-Motif Receptor 1 (CX3CR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Chemokine C-X3-C-Motif Receptor 1 (CX3CR1) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Chemokine C-X3-C-Motif Receptor 1 (CX3CR1) ELISA Kit

DLR-CX3CR1-Mu-96T 96T
EUR 661
  • Should the Mouse Chemokine C-X3-C-Motif Receptor 1 (CX3CR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Chemokine C-X3-C-Motif Receptor 1 (CX3CR1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Chemokine C-X3-C-Motif Receptor 1 (CX3CR1) ELISA Kit

RDR-CX3CR1-Hu-48Tests 48 Tests
EUR 522

Human Chemokine C-X3-C-Motif Receptor 1 (CX3CR1) ELISA Kit

RDR-CX3CR1-Hu-96Tests 96 Tests
EUR 724

Mouse Chemokine C-X3-C-Motif Receptor 1 (CX3CR1) ELISA Kit

RDR-CX3CR1-Mu-48Tests 48 Tests
EUR 534

Mouse Chemokine C-X3-C-Motif Receptor 1 (CX3CR1) ELISA Kit

RDR-CX3CR1-Mu-96Tests 96 Tests
EUR 742

Human Chemokine C-X3-C-Motif Receptor 1 (CX3CR1) ELISA Kit

RD-CX3CR1-Hu-48Tests 48 Tests
EUR 500

Human Chemokine C-X3-C-Motif Receptor 1 (CX3CR1) ELISA Kit

RD-CX3CR1-Hu-96Tests 96 Tests
EUR 692

Mouse Chemokine C-X3-C-Motif Receptor 1 (CX3CR1) ELISA Kit

RD-CX3CR1-Mu-48Tests 48 Tests
EUR 511

Mouse Chemokine C-X3-C-Motif Receptor 1 (CX3CR1) ELISA Kit

RD-CX3CR1-Mu-96Tests 96 Tests
EUR 709

Cx3cr1/ Rat Cx3cr1 ELISA Kit

ELI-05022r 96 Tests
EUR 886

CX3CR1 Antibody

24056-100ul 100ul
EUR 390

CX3CR1 Antibody

24082-100ul 100ul
EUR 390

CX3CR1 antibody

70R-16679 50 ul
EUR 435
Description: Rabbit polyclonal CX3CR1 antibody

CX3CR1 antibody

70R-12357 100 ug
EUR 403
Description: Rabbit polyclonal CX3CR1 antibody

CX3CR1 antibody

70R-30895 100 ug
EUR 327
Description: Rabbit polyclonal CX3CR1 antibody

CX3CR1 Antibody

36817-100ul 100ul
EUR 252

CX3CR1 antibody

38481-100ul 100ul
EUR 252

CX3CR1 Antibody

1-CSB-PA004776
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CX3CR1. Recognizes CX3CR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

CX3CR1 Antibody

1-CSB-PA006236GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CX3CR1. Recognizes CX3CR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CX3CR1 Antibody

1-CSB-PA006236LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CX3CR1. Recognizes CX3CR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

CX3CR1 Antibody

1-CSB-PA080771
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CX3CR1. Recognizes CX3CR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000

CX3CR1 Antibody

1-CSB-PA135132
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CX3CR1. Recognizes CX3CR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:500-1:2000

CX3CR1 Antibody

DF7096 200ul
EUR 304
Description: CX3CR1 Antibody detects endogenous levels of total CX3CR1.

CX3CR1 Antibody

DF2325 200ul
EUR 304
Description: CX3CR1 antibody detects endogenous levels of total CX3CR1.

CX3CR1 Antibody

1-CSB-PA007487
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CX3CR1. Recognizes CX3CR1 from Human. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

CX3CR1 siRNA

20-abx901346
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CX3CR1 siRNA

20-abx913229
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CX3CR1 siRNA

20-abx913230
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CX3CR1 Antibody

ABD2325 100 ug
EUR 438

CX3CR1 Antibody

ABD7096 100 ug
EUR 438

CX3CR1 antibody

PAab10034 100 ug
EUR 386

anti-CX3CR1

YF-PA11219 50 ug
EUR 363
Description: Mouse polyclonal to CX3CR1

CX3CR1 Blocking Peptide

33R-11045 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CX3CR1 antibody, catalog no. 70R-12357

CX3CR1 antibody (biotin)

61R-1649 100 ug
EUR 478
Description: Rat monoclonal CX3CR1 antibody (biotin)

CX3CR1/RBS11 Antibody

5537R-100
EUR 316

CX3CR1/RBS11 Antibody

5537R-30T
EUR 146

CX3CR1 Blocking Peptide

DF7096-BP 1mg
EUR 195

CX3CR1 Blocking Peptide

DF2325-BP 1mg
EUR 195

CX3CR1 Conjugated Antibody

C36817 100ul
EUR 397

CX3CR1 Conjugated Antibody

C38481 100ul
EUR 397

Polyclonal CX3CR1 Antibody

APR06242G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CX3CR1 . This antibody is tested and proven to work in the following applications:

Polyclonal CX3CR1 Antibody

APR06258G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CX3CR1 . This antibody is tested and proven to work in the following applications:

CX3CR1 cloning plasmid

CSB-CL006236HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1068
  • Sequence: atggatcagttccctgaatcagtgacagaaaactttgagtacgatgatttggctgaggcctgttatattggggacatcgtggtctttgggactgtgttcctgtccatattctactccgtcatctttgccattggcctggtgggaaatttgttggtagtgtttgccctcaccaaca
  • Show more
Description: A cloning plasmid for the CX3CR1 gene.

CX3CR1 Polyclonal Antibody

ABP53915-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human CX3CR1 at AA rangle: 270-350
  • Applications tips:
Description: A polyclonal antibody for detection of CX3CR1 from Human. This CX3CR1 antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human CX3CR1 at AA rangle: 270-350

CX3CR1 Polyclonal Antibody

ABP53915-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human CX3CR1 at AA rangle: 270-350
  • Applications tips:
Description: A polyclonal antibody for detection of CX3CR1 from Human. This CX3CR1 antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human CX3CR1 at AA rangle: 270-350

CX3CR1 Polyclonal Antibody

ABP53915-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human CX3CR1 at AA rangle: 270-350
  • Applications tips:
Description: A polyclonal antibody for detection of CX3CR1 from Human. This CX3CR1 antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human CX3CR1 at AA rangle: 270-350

CX3CR1 Rabbit pAb

A2890-100ul 100 ul
EUR 308

CX3CR1 Rabbit pAb

A2890-200ul 200 ul
EUR 459

CX3CR1 Rabbit pAb

A2890-20ul 20 ul
EUR 183

CX3CR1 Rabbit pAb

A2890-50ul 50 ul
EUR 223

CX3CR1 Polyclonal Antibody

ES4914-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CX3CR1 from Human. This antibody is tested and validated for IHC, IF, WB, ELISA

CX3CR1 Polyclonal Antibody

ES4914-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CX3CR1 from Human. This antibody is tested and validated for IHC, IF, WB, ELISA

anti- CX3CR1 antibody

FNab10034 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: chemokine(C-X3-C motif) receptor 1
  • Uniprot ID: P49238
  • Gene ID: 1524
  • Research Area: Neuroscience, Stem Cells, Immunology, Signal Transduction
Description: Antibody raised against CX3CR1

anti- CX3CR1 antibody

FNab02090 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • Immunogen: chemokine(C-X3-C motif) receptor 1
  • Uniprot ID: P49238
  • Gene ID: 1524
  • Research Area: Neuroscience, Stem Cells, Immunology, Signal Transduction
Description: Antibody raised against CX3CR1

Anti-CX3CR1 antibody

PAab02090 100 ug
EUR 355

Anti-CX3CR1 antibody

STJ92525 200 µl
EUR 197
Description: Rabbit polyclonal to CX3CR1.

Anti-CX3CR1 antibody

STJ23295 100 µl
EUR 277
Description: Fractalkine is a transmembrane protein and chemokine involved in the adhesion and migration of leukocytes. The protein encoded by this gene is a receptor for fractalkine. The encoded protein also is a coreceptor for HIV-1, and some variations in this gene lead to increased susceptibility to HIV-1 infection and rapid progression to AIDS. Four transcript variants encoding two different isoforms have been found for this gene.

Anti-CX3CR1 (2B11)

YF-MA10217 100 ug
EUR 363
Description: Mouse monoclonal to CX3CR1

Anti-CX3CR1 (10D5)

YF-MA10218 100 ug
EUR 363
Description: Mouse monoclonal to CX3CR1

CX3CR1/RBS11 Blocking Peptide

5537RBP-50
EUR 153

CX3CR1 Antibody, HRP conjugated

1-CSB-PA006236LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CX3CR1. Recognizes CX3CR1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CX3CR1 Antibody, FITC conjugated

1-CSB-PA006236LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CX3CR1. Recognizes CX3CR1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CX3CR1 Antibody, Biotin conjugated

1-CSB-PA006236LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CX3CR1. Recognizes CX3CR1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal CX3CR1/RBS11 Antibody

APR00286G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CX3CR1/RBS11 . This antibody is tested and proven to work in the following applications:

Anti-CX3CR1 (NT) Antibody

A00280 100ug
EUR 471
Description: Rabbit Polyclonal CX3CR1 (NT) Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Human CX3CR1 ELISA Kit

EHC0345 96Tests
EUR 521

Human CX3CR1 ELISA Kit

ELA-E1523h 96 Tests
EUR 824

Goat CX3CR1 ELISA Kit

EGTC0345 96Tests
EUR 521