Human ATPase, H+ Transporting, Lysosomal Accessory Protein 2 (ATP6AP2) ELISA Kit

DLR-ATP6AP2-Hu-96T 96T
EUR 673
  • Should the Human ATPase, H+ Transporting, Lysosomal Accessory Protein 2 (ATP6AP2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human ATPase, H+ Transporting, Lysosomal Accessory Protein 2 (ATP6AP2) in samples from tissue homogenates or other biological fluids.

Mouse ATPase, H+ Transporting, Lysosomal Accessory Protein 2 (ATP6AP2) ELISA Kit

DLR-ATP6AP2-Mu-48T 48T
EUR 527
  • Should the Mouse ATPase, H+ Transporting, Lysosomal Accessory Protein 2 (ATP6AP2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse ATPase, H+ Transporting, Lysosomal Accessory Protein 2 (ATP6AP2) in samples from tissue homogenates or other biological fluids.

Mouse ATPase, H+ Transporting, Lysosomal Accessory Protein 2 (ATP6AP2) ELISA Kit

DLR-ATP6AP2-Mu-96T 96T
EUR 688
  • Should the Mouse ATPase, H+ Transporting, Lysosomal Accessory Protein 2 (ATP6AP2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse ATPase, H+ Transporting, Lysosomal Accessory Protein 2 (ATP6AP2) in samples from tissue homogenates or other biological fluids.

Rat ATPase, H+ Transporting, Lysosomal Accessory Protein 2 (ATP6AP2) ELISA Kit

DLR-ATP6AP2-Ra-48T 48T
EUR 549
  • Should the Rat ATPase, H+ Transporting, Lysosomal Accessory Protein 2 (ATP6AP2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat ATPase, H+ Transporting, Lysosomal Accessory Protein 2 (ATP6AP2) in samples from tissue homogenates or other biological fluids.

Rat ATPase, H+ Transporting, Lysosomal Accessory Protein 2 (ATP6AP2) ELISA Kit

DLR-ATP6AP2-Ra-96T 96T
EUR 718
  • Should the Rat ATPase, H+ Transporting, Lysosomal Accessory Protein 2 (ATP6AP2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat ATPase, H+ Transporting, Lysosomal Accessory Protein 2 (ATP6AP2) in samples from tissue homogenates or other biological fluids.

Human ATPase, H+ Transporting, Lysosomal Accessory Protein 2 (ATP6AP2) ELISA Kit

RDR-ATP6AP2-Hu-48Tests 48 Tests
EUR 544

Human ATPase, H+ Transporting, Lysosomal Accessory Protein 2 (ATP6AP2) ELISA Kit

RDR-ATP6AP2-Hu-96Tests 96 Tests
EUR 756

Mouse ATPase, H+ Transporting, Lysosomal Accessory Protein 2 (ATP6AP2) ELISA Kit

RDR-ATP6AP2-Mu-48Tests 48 Tests
EUR 557

Mouse ATPase, H+ Transporting, Lysosomal Accessory Protein 2 (ATP6AP2) ELISA Kit

RDR-ATP6AP2-Mu-96Tests 96 Tests
EUR 774

Rat ATPase, H+ Transporting, Lysosomal Accessory Protein 2 (ATP6AP2) ELISA Kit

RDR-ATP6AP2-Ra-48Tests 48 Tests
EUR 583

Rat ATPase, H+ Transporting, Lysosomal Accessory Protein 2 (ATP6AP2) ELISA Kit

RDR-ATP6AP2-Ra-96Tests 96 Tests
EUR 811

Human ATPase, H+ Transporting, Lysosomal Accessory Protein 2 (ATP6AP2) ELISA Kit

RD-ATP6AP2-Hu-48Tests 48 Tests
EUR 521

Human ATPase, H+ Transporting, Lysosomal Accessory Protein 2 (ATP6AP2) ELISA Kit

RD-ATP6AP2-Hu-96Tests 96 Tests
EUR 723

Mouse ATPase, H+ Transporting, Lysosomal Accessory Protein 2 (ATP6AP2) ELISA Kit

RD-ATP6AP2-Mu-48Tests 48 Tests
EUR 533

Mouse ATPase, H+ Transporting, Lysosomal Accessory Protein 2 (ATP6AP2) ELISA Kit

RD-ATP6AP2-Mu-96Tests 96 Tests
EUR 740

Rat ATPase, H+ Transporting, Lysosomal Accessory Protein 2 (ATP6AP2) ELISA Kit

RD-ATP6AP2-Ra-48Tests 48 Tests
EUR 557

Rat ATPase, H+ Transporting, Lysosomal Accessory Protein 2 (ATP6AP2) ELISA Kit

RD-ATP6AP2-Ra-96Tests 96 Tests
EUR 775

Atp6ap2/ Rat Atp6ap2 ELISA Kit

ELI-03578r 96 Tests
EUR 886

ATP6AP2 antibody

70R-21668 50 ul
EUR 435
Description: Rabbit polyclonal ATP6AP2 antibody

ATP6AP2 Antibody

36270-100ul 100ul
EUR 252

ATP6AP2 antibody

38984-100ul 100ul
EUR 252

ATP6AP2 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ATP6AP2. Recognizes ATP6AP2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

ATP6AP2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ATP6AP2. Recognizes ATP6AP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ATP6AP2 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATP6AP2. Recognizes ATP6AP2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

ATP6AP2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ATP6AP2. Recognizes ATP6AP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

ATP6AP2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ATP6AP2. Recognizes ATP6AP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

ATP6AP2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ATP6AP2. Recognizes ATP6AP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ATP6AP2 Conjugated Antibody

C36270 100ul
EUR 397

ATP6AP2 cloning plasmid

CSB-CL002384HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 300
  • Sequence: atgtacagtctttatggtgggaatgcagtggtagagttagtcactgtcaagtcatttgacacctccctcattaggaagacaaggactatccttgaggcaaaacaagcgaacccagcaagtccctataaccttgcatataagtataattttgaatattccgtggttttcaacatggt
  • Show more
Description: A cloning plasmid for the ATP6AP2 gene.

ATP6AP2 cloning plasmid

CSB-CL002384HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1053
  • Show more
Description: A cloning plasmid for the ATP6AP2 gene.

ATP6AP2 Rabbit pAb

A4380-100ul 100 ul
EUR 308

ATP6AP2 Rabbit pAb

A4380-200ul 200 ul
EUR 459

ATP6AP2 Rabbit pAb

A4380-20ul 20 ul Ask for price

ATP6AP2 Rabbit pAb

A4380-50ul 50 ul Ask for price

ATP6AP2 Polyclonal Antibody

A57277 100 µg
EUR 570.55
Description: The best epigenetics products

ATP6AP2 Rabbit pAb

A6531-100ul 100 ul
EUR 308

ATP6AP2 Rabbit pAb

A6531-200ul 200 ul
EUR 459

ATP6AP2 Rabbit pAb

A6531-20ul 20 ul
EUR 183

ATP6AP2 Rabbit pAb

A6531-50ul 50 ul
EUR 223

Anti-ATP6AP2 antibody

STJ28614 100 µl
EUR 277
Description: This gene encodes a protein that is associated with adenosine triphosphatases (ATPases). Proton-translocating ATPases have fundamental roles in energy conservation, secondary active transport, acidification of intracellular compartments, and cellular pH homeostasis. There are three classes of ATPases- F, P, and V. The vacuolar (V-type) ATPases have a transmembrane proton-conducting sector and an extramembrane catalytic sector. The encoded protein has been found associated with the transmembrane sector of the V-type ATPases.

Anti-ATP6AP2 antibody

STJ22725 100 µl
EUR 277
Description: This gene encodes a protein that is associated with adenosine triphosphatases (ATPases). Proton-translocating ATPases have fundamental roles in energy conservation, secondary active transport, acidification of intracellular compartments, and cellular pH homeostasis. There are three classes of ATPases- F, P, and V. The vacuolar (V-type) ATPases have a transmembrane proton-conducting sector and an extramembrane catalytic sector. The encoded protein has been found associated with the transmembrane sector of the V-type ATPases.

ATP6AP2 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATP6AP2. Recognizes ATP6AP2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ATP6AP2 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATP6AP2. Recognizes ATP6AP2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ATP6AP2 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATP6AP2. Recognizes ATP6AP2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human Renin receptor (ATP6AP2)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 41.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Renin receptor(ATP6AP2) expressed in E.coli

Human Renin receptor (ATP6AP2)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 53.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Renin receptor(ATP6AP2) expressed in E.coli

Human Renin receptor (ATP6AP2)

  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 40 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Renin receptor(ATP6AP2) expressed in Yeast