ASGR2

Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit

DLR-ASGR2-Hu-96T 96T
EUR 673
  • Should the Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Asialoglycoprotein Receptor 2 (ASGR2) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit

RD-ASGR2-Hu-48Tests 48 Tests
EUR 521

Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit

RD-ASGR2-Hu-96Tests 96 Tests
EUR 723

Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit

RDR-ASGR2-Hu-48Tests 48 Tests
EUR 544

Human Asialoglycoprotein Receptor 2 (ASGR2) ELISA Kit

RDR-ASGR2-Hu-96Tests 96 Tests
EUR 756

Asgr2/ Rat Asgr2 ELISA Kit

ELI-11273r 96 Tests
EUR 886

ASGR2 siRNA

20-abx900475
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ASGR2 siRNA

20-abx908332
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ASGR2 siRNA

20-abx908333
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ASGR2 Protein

20-abx260966
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

ASGR2 antibody

70R-2075 50 ug
EUR 467
Description: Rabbit polyclonal ASGR2 antibody raised against the N terminal of ASGR2

ASGR2 Antibody

39942-100ul 100ul
EUR 390

ASGR2 antibody

70R-1145 100 ug
EUR 377
Description: Rabbit polyclonal ASGR2 antibody raised against the N terminal of ASGR2

ASGR2 antibody

70R-15866 50 ul
EUR 435
Description: Rabbit polyclonal ASGR2 antibody

ASGR2 Antibody

1-CSB-PA002208GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ASGR2. Recognizes ASGR2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ASGR2 Antibody

1-CSB-PA002208LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASGR2. Recognizes ASGR2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

anti- ASGR2 antibody

FNab00636 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IP: 1:200-1:1000
  • IHC: 1:50-1:500
  • Immunogen: asialoglycoprotein receptor 2
  • Uniprot ID: P07307
  • Gene ID: 433
  • Research Area: Immunology, Signal Transduction
Description: Antibody raised against ASGR2

ASGR2 Rabbit pAb

A11830-100ul 100 ul
EUR 308

ASGR2 Rabbit pAb

A11830-200ul 200 ul
EUR 459

ASGR2 Rabbit pAb

A11830-20ul 20 ul Ask for price

ASGR2 Rabbit pAb

A11830-50ul 50 ul Ask for price

ASGR2 Polyclonal Antibody

A62110 100 µg
EUR 570.55
Description: Ask the seller for details

ASGR2 Rabbit pAb

A6281-100ul 100 ul
EUR 308

ASGR2 Rabbit pAb

A6281-200ul 200 ul
EUR 459

ASGR2 Rabbit pAb

A6281-20ul 20 ul
EUR 183

ASGR2 Rabbit pAb

A6281-50ul 50 ul
EUR 223

ASGR2 Rabbit pAb

A13949-100ul 100 ul
EUR 308

ASGR2 Rabbit pAb

A13949-200ul 200 ul
EUR 459

ASGR2 Rabbit pAb

A13949-20ul 20 ul
EUR 183

ASGR2 Rabbit pAb

A13949-50ul 50 ul
EUR 223

ASGR2 Blocking Peptide

33R-5548 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ASGR2 antibody, catalog no. 70R-2075

ASGR2 Blocking Peptide

33R-8876 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ASGR2 antibody, catalog no. 70R-1145

Human ASGR2 Antibody

33449-05111 150 ug
EUR 261

ASGR2 Polyclonal Antibody

30711-100ul 100ul
EUR 252

ASGR2 Polyclonal Antibody

30711-50ul 50ul
EUR 187

ASGR2 Polyclonal Antibody

28410-100ul 100ul
EUR 252

ASGR2 Polyclonal Antibody

28410-50ul 50ul
EUR 187

ASGR2 cloning plasmid

CSB-CL002208HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 864
  • Sequence: atggccaaggactttcaagatatccagcagctgagctcggaggaaaatgaccatcctttccatcaagggccacctcctgcccagcccctggcacagcgtctctgctccatggtctgcttcagtctgcttgccctgagcttcaacatcctgctgctggtggtcatctgtgtgactgg
  • Show more
Description: A cloning plasmid for the ASGR2 gene.

Anti-ASGR2 antibody

PAab00636 100 ug
EUR 355

pENTR223-ASGR2 vector

PVT11940 2 ug
EUR 308

Anti-ASGR2 antibody

STJ28203 100 µl
EUR 277
Description: This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the less abundant minor subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Anti-ASGR2 antibody

STJ113409 100 µl
EUR 277
Description: This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the less abundant minor subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Anti-ASGR2 antibody

STJ115884 100 µl
EUR 277
Description: This gene encodes a subunit of the asialoglycoprotein receptor. This receptor is a transmembrane protein that plays a critical role in serum glycoprotein homeostasis by mediating the endocytosis and lysosomal degradation of glycoproteins with exposed terminal galactose or N-acetylgalactosamine residues. The asialoglycoprotein receptor may facilitate hepatic infection by multiple viruses including hepatitis B, and is also a target for liver-specific drug delivery. The asialoglycoprotein receptor is a hetero-oligomeric protein composed of major and minor subunits, which are encoded by different genes. The protein encoded by this gene is the less abundant minor subunit. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

ASGR2 Polyclonal Conjugated Antibody

C30711 100ul
EUR 397

ASGR2 Polyclonal Conjugated Antibody

C28410 100ul
EUR 397

Rat ASGR2 shRNA Plasmid

20-abx985475
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ASGR2 ELISA KIT|Human

EF006617 96 Tests
EUR 689

Human ASGR2 shRNA Plasmid

20-abx950312
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ASGR2 protein (His tag)

80R-2528 50 ul
EUR 208
Description: Purified recombinant ASGR2 protein (His tag)

Mouse ASGR2 shRNA Plasmid

20-abx969249
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.