  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ARFGAP1 antibody

70R-35647 100 ug
EUR 349
Description: Rabbit polyclonal ARFGAP1 antibody

ARFGAP1 antibody

70R-34003 100 ug
EUR 327
Description: Rabbit polyclonal ARFGAP1 antibody

ARFGAP1 antibody

70R-9476 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal ARFGAP1 antibody

ARFGAP1 antibody

70R-9477 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal ARFGAP1 antibody

ARFGAP1 Antibody

ABD3747 100 ug
EUR 438

ARFGAP1 Antibody

36127-100ul 100ul
EUR 252

ARFGAP1 antibody

10R-3348 100 ul
EUR 691
Description: Mouse monoclonal ARFGAP1 antibody

ARFGAP1 antibody

10R-3350 100 ul
EUR 691
Description: Mouse monoclonal ARFGAP1 antibody

ARFGAP1 antibody

10R-3351 100 ul
EUR 691
Description: Mouse monoclonal ARFGAP1 antibody

ARFGAP1 antibody

10R-3352 100 ul
EUR 726
Description: Mouse monoclonal ARFGAP1 antibody

ARFGAP1 antibody

10R-3353 100 ul
EUR 691
Description: Mouse monoclonal ARFGAP1 antibody

ARFGAP1 antibody

10R-3354 100 ul
EUR 691
Description: Mouse monoclonal ARFGAP1 antibody

ARFGAP1 antibody

70R-15793 50 ul
EUR 435
Description: Rabbit polyclonal ARFGAP1 antibody

ARFGAP1 Antibody

DF3747 200ul
EUR 304
Description: ARFGAP1 Antibody detects endogenous levels of total ARFGAP1.

ARFGAP1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against ARFGAP1. Recognizes ARFGAP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

ARFGAP1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ARFGAP1. Recognizes ARFGAP1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

ARFGAP1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against ARFGAP1. Recognizes ARFGAP1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

ARFGAP1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ARFGAP1. Recognizes ARFGAP1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:25-1:100

ARFGAP1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ARFGAP1. Recognizes ARFGAP1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:10000, WB:1:1000-1:5000

ARFGAP1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ARFGAP1. Recognizes ARFGAP1 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000

ARFGAP1 antibody

PAab10028 100 ug
EUR 386

ARFGAP1 Conjugated Antibody

C36127 100ul
EUR 397

anti- ARFGAP1 antibody

FNab00536 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:100
  • Immunogen: ADP-ribosylation factor GTPase activating protein 1
  • Uniprot ID: Q8N6T3
  • Gene ID: 55738
  • Research Area: Signal Transduction
Description: Antibody raised against ARFGAP1

anti- ARFGAP1 antibody

FNab10028 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:50-1:500
  • Immunogen: ADP-ribosylation factor GTPase activating protein 1
  • Uniprot ID: Q8N6T3
  • Gene ID: 55738
  • Research Area: Signal Transduction
Description: Antibody raised against ARFGAP1

ARFGAP1 Rabbit pAb

A7118-100ul 100 ul
EUR 308

ARFGAP1 Rabbit pAb

A7118-200ul 200 ul
EUR 459

ARFGAP1 Rabbit pAb

A7118-20ul 20 ul
EUR 183

ARFGAP1 Rabbit pAb

A7118-50ul 50 ul
EUR 223

Anti-ARFGAP1 Antibody

A04959 100ug/vial
EUR 294

ARFGAP1 Rabbit pAb

A12595-100ul 100 ul
EUR 308

ARFGAP1 Rabbit pAb

A12595-200ul 200 ul
EUR 459

ARFGAP1 Rabbit pAb

A12595-20ul 20 ul
EUR 183

ARFGAP1 Rabbit pAb

A12595-50ul 50 ul
EUR 223

ARFGAP1 Blocking Peptide

33R-3508 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ARFGAP1 antibody, catalog no. 70R-9476

ARFGAP1 Blocking Peptide

33R-9999 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ARFGAP1 antibody, catalog no. 70R-9477

ARFGAP1 Blocking Peptide

DF3747-BP 1mg
EUR 195

ARFGAP1 cloning plasmid

CSB-CL843284HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1245
  • Sequence: atggccagcccaagaaccaggaaggttcttaaagaagtcagggtgcaggatgagaacaacgtttgttttgagtgtggcgcgttcaatcctcagtgggtcagtgtgacctacggcatctggatctgcctggagtgctcggggagacaccgcgggcttggggttcacctcagctttg
  • Show more
Description: A cloning plasmid for the ARFGAP1 gene.

ARFGAP1 cloning plasmid

CSB-CL843284HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1212
  • Sequence: atggccagcccaagaaccaggaaggttcttaaagaagtcagggtgcaggatgagaacaacgtttgttttgagtgtggcgcgttcaatcctcagtgggtcagtgtgacctacggcatctggatctgcctggagtgctcggggagacaccgcgggcttggggttcacctcagctttg
  • Show more
Description: A cloning plasmid for the ARFGAP1 gene.

Anti-ARFGAP1 antibody

PAab00536 100 ug
EUR 355

Anti-ARFGAP1 antibody

STJ29198 100 µl
EUR 277
Description: The protein encoded by this gene is a GTPase-activating protein, which associates with the Golgi apparatus and which interacts with ADP-ribosylation factor 1. The encoded protein promotes hydrolysis of ADP-ribosylation factor 1-bound GTP and is required for the dissociation of coat proteins from Golgi-derived membranes and vesicles. Dissociation of the coat proteins is required for the fusion of these vesicles with target compartments. The activity of this protein is stimulated by phosphoinosides and inhibited by phosphatidylcholine. Alternative splicing results in multiple transcript variants.

Anti-ARFGAP1 antibody

STJ114469 100 µl
EUR 277
Description: The protein encoded by this gene is a GTPase-activating protein, which associates with the Golgi apparatus and which interacts with ADP-ribosylation factor 1. The encoded protein promotes hydrolysis of ADP-ribosylation factor 1-bound GTP and is required for the dissociation of coat proteins from Golgi-derived membranes and vesicles. Dissociation of the coat proteins is required for the fusion of these vesicles with target compartments. The activity of this protein is stimulated by phosphoinosides and inhibited by phosphatidylcholine. Alternative splicing results in multiple transcript variants.

Rat ARFGAP1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.


ELI-11728h 96 Tests
EUR 824


EF007851 96 Tests
EUR 689

Mouse Arfgap1 ELISA KIT

ELI-34816m 96 Tests
EUR 865

Human ARFGAP1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ARFGAP1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.