XBP1

Human X-Box Binding Protein 1 (XBP1) ELISA Kit
DLR-XBP1-Hu-96T 96T
EUR 673
  • Should the Human X-Box Binding Protein 1 (XBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human X-Box Binding Protein 1 (XBP1) in samples from tissue homogenates, cell lysates or other biological fluids.
Mouse X-Box Binding Protein 1 (XBP1) ELISA Kit
DLR-XBP1-Mu-48T 48T
EUR 527
  • Should the Mouse X-Box Binding Protein 1 (XBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse X-Box Binding Protein 1 (XBP1) in samples from tissue homogenates or other biological fluids.
Mouse X-Box Binding Protein 1 (XBP1) ELISA Kit
DLR-XBP1-Mu-96T 96T
EUR 688
  • Should the Mouse X-Box Binding Protein 1 (XBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse X-Box Binding Protein 1 (XBP1) in samples from tissue homogenates or other biological fluids.
Human X-Box Binding Protein 1 (XBP1) ELISA Kit
RDR-XBP1-Hu-48Tests 48 Tests
EUR 544
Human X-Box Binding Protein 1 (XBP1) ELISA Kit
RDR-XBP1-Hu-96Tests 96 Tests
EUR 756
Mouse X-Box Binding Protein 1 (XBP1) ELISA Kit
RDR-XBP1-Mu-48Tests 48 Tests
EUR 557
Mouse X-Box Binding Protein 1 (XBP1) ELISA Kit
RDR-XBP1-Mu-96Tests 96 Tests
EUR 774
Human X-Box Binding Protein 1 (XBP1) ELISA Kit
RD-XBP1-Hu-48Tests 48 Tests
EUR 521
Human X-Box Binding Protein 1 (XBP1) ELISA Kit
RD-XBP1-Hu-96Tests 96 Tests
EUR 723
Mouse X-Box Binding Protein 1 (XBP1) ELISA Kit
RD-XBP1-Mu-48Tests 48 Tests
EUR 533
Mouse X-Box Binding Protein 1 (XBP1) ELISA Kit
RD-XBP1-Mu-96Tests 96 Tests
EUR 740
Xbp1/ Rat Xbp1 ELISA Kit
ELI-07687r 96 Tests
EUR 886
XBP1 Antibody
35984-100ul 100ul
EUR 252
XBP1 antibody
10R-1898 100 ul
EUR 349
Description: Mouse monoclonal XBP1 antibody
XBP1 antibody
10R-1263 100 ug
EUR 512
Description: Mouse monoclonal XBP1 antibody
XBP1 Antibody
49436-100ul 100ul
EUR 333
XBP1 Antibody
49436-50ul 50ul
EUR 239
XBP1 Antibody
1-CSB-PA05319A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against XBP1. Recognizes XBP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
XBP1 Antibody
1-CSB-PA748751
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against XBP1. Recognizes XBP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
XBP1 Antibody
1-CSB-PA027191
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against XBP1. Recognizes XBP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200
XBP1 Antibody
CSB-PA026183KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against XBP1. Recognizes XBP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200
XBP1 Antibody
CSB-PA026183KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against XBP1. Recognizes XBP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200
XBP1 Antibody
AF5110 200ul
EUR 304
Description: XBP1 Antibody detects endogenous levels of total XBP1.
XBP1 Antibody
BF0537 200ul
EUR 376
Description: XBP1 antibody detects endogenous levels of total XBP1.
XBP1 siRNA
20-abx906101
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
XBP1 siRNA
20-abx939966
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
XBP1 siRNA
20-abx939967
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
XBP1 Antibody
ABF5110 100 ug
EUR 438
anti-XBP1
YF-PA15328 50 ug
EUR 363
Description: Mouse polyclonal to XBP1
anti-XBP1
YF-PA15329 100 ul
EUR 403
Description: Rabbit polyclonal to XBP1
anti-XBP1
YF-PA15330 100 ug
EUR 403
Description: Rabbit polyclonal to XBP1
XBP1 Rabbit pAb
A14651-100ul 100 ul
EUR 308
XBP1 Rabbit pAb
A14651-200ul 200 ul
EUR 459
XBP1 Rabbit pAb
A14651-20ul 20 ul
EUR 183
XBP1 Rabbit pAb
A14651-50ul 50 ul
EUR 223
XBP1 Conjugated Antibody
C49436 100ul
EUR 397
XBP1 Blocking Peptide
AF5110-BP 1mg
EUR 195
XBP1 Conjugated Antibody
C35984 100ul
EUR 397
XBP1 Blocking Peptide
BF0537-BP 1mg
EUR 195
XBP1 cloning plasmid
CSB-CL026183HU-10ug 10ug
EUR 329
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 786
  • Sequence: atggtggtggtggcagccgcgccgaacccggccgacgggacccctaaagttctgcttctgtcggggcagcccgcctccgccgccggagccccggccggccaggccctgccgctcatggtgccagcccagagaggggccagcccggaggcagcgagcggggggctgccccaggcgcg
  • Show more
Description: A cloning plasmid for the XBP1 gene.
XBP1 Rabbit pAb
A14796-100ul 100 ul
EUR 308
XBP1 Rabbit pAb
A14796-200ul 200 ul
EUR 459
XBP1 Rabbit pAb
A14796-20ul 20 ul
EUR 183
XBP1 Rabbit pAb
A14796-50ul 50 ul
EUR 223
XBP1 Rabbit pAb
A14860-100ul 100 ul
EUR 308
XBP1 Rabbit pAb
A14860-200ul 200 ul
EUR 459
XBP1 Rabbit pAb
A14860-20ul 20 ul
EUR 183
XBP1 Rabbit pAb
A14860-50ul 50 ul
EUR 223
XBP1 Rabbit pAb
A1731-100ul 100 ul
EUR 308
XBP1 Rabbit pAb
A1731-200ul 200 ul
EUR 459
XBP1 Rabbit pAb
A1731-20ul 20 ul
EUR 183
XBP1 Rabbit pAb
A1731-50ul 50 ul
EUR 223
anti- XBP1 antibody
FNab09537 100µg
EUR 585
  • Recommended dilution: WB: 1:200-1:1000
  • IHC: 1:50-1:500
  • Immunogen: X-box binding protein 1
  • Uniprot ID: P17861
  • Gene ID: 7494
  • Research Area: Metabolism
Description: Antibody raised against XBP1
anti-XBP1 (1C4)
LF-MA30383 100 ul
EUR 445
Description: Mouse Monoclonal to XBP1
Anti-XBP1 antibody
PAab09537 100 ug
EUR 412
Anti-XBP1 Antibody
PB9463 100ug/vial
EUR 334
pCMV-SPORT6-XBP1
PVT12500 2 ug
EUR 391
Anti-XBP1 antibody
STJ116857 100 µl
EUR 277
Description: This gene encodes a transcription factor that regulates MHC class II genes by binding to a promoter element referred to as an X box. This gene product is a bZIP protein, which was also identified as a cellular transcription factor that binds to an enhancer in the promoter of the T cell leukemia virus type 1 promoter. It may increase expression of viral proteins by acting as the DNA binding partner of a viral transactivator. It has been found that upon accumulation of unfolded proteins in the endoplasmic reticulum (ER), the mRNA of this gene is processed to an active form by an unconventional splicing mechanism that is mediated by the endonuclease inositol-requiring enzyme 1 (IRE1). The resulting loss of 26 nt from the spliced mRNA causes a frame-shift and an isoform XBP1(S), which is the functionally active transcription factor. The isoform encoded by the unspliced mRNA, XBP1(U), is constitutively expressed, and thought to function as a negative feedback regulator of XBP1(S), which shuts off transcription of target genes during the recovery phase of ER stress. A pseudogene of XBP1 has been identified and localized to chromosome 5.
Anti-XBP1 antibody
STJ116996 100 µl
EUR 277
Description: This gene encodes a transcription factor that regulates MHC class II genes by binding to a promoter element referred to as an X box. This gene product is a bZIP protein, which was also identified as a cellular transcription factor that binds to an enhancer in the promoter of the T cell leukemia virus type 1 promoter. It may increase expression of viral proteins by acting as the DNA binding partner of a viral transactivator. It has been found that upon accumulation of unfolded proteins in the endoplasmic reticulum (ER), the mRNA of this gene is processed to an active form by an unconventional splicing mechanism that is mediated by the endonuclease inositol-requiring enzyme 1 (IRE1). The resulting loss of 26 nt from the spliced mRNA causes a frame-shift and an isoform XBP1(S), which is the functionally active transcription factor. The isoform encoded by the unspliced mRNA, XBP1(U), is constitutively expressed, and thought to function as a negative feedback regulator of XBP1(S), which shuts off transcription of target genes during the recovery phase of ER stress. A pseudogene of XBP1 has been identified and localized to chromosome 5.
Anti-XBP1 antibody
STJ117060 100 µl
EUR 277
Description: This gene encodes a transcription factor that regulates MHC class II genes by binding to a promoter element referred to as an X box. This gene product is a bZIP protein, which was also identified as a cellular transcription factor that binds to an enhancer in the promoter of the T cell leukemia virus type 1 promoter. It may increase expression of viral proteins by acting as the DNA binding partner of a viral transactivator. It has been found that upon accumulation of unfolded proteins in the endoplasmic reticulum (ER), the mRNA of this gene is processed to an active form by an unconventional splicing mechanism that is mediated by the endonuclease inositol-requiring enzyme 1 (IRE1). The resulting loss of 26 nt from the spliced mRNA causes a frame-shift and an isoform XBP1(S), which is the functionally active transcription factor. The isoform encoded by the unspliced mRNA, XBP1(U), is constitutively expressed, and thought to function as a negative feedback regulator of XBP1(S), which shuts off transcription of target genes during the recovery phase of ER stress. A pseudogene of XBP1 has been identified and localized to chromosome 5.
Anti-XBP1 antibody
STJ29865 100 µl
EUR 277
Description: This gene encodes a transcription factor that regulates MHC class II genes by binding to a promoter element referred to as an X box. This gene product is a bZIP protein, which was also identified as a cellular transcription factor that binds to an enhancer in the promoter of the T cell leukemia virus type 1 promoter. It may increase expression of viral proteins by acting as the DNA binding partner of a viral transactivator. It has been found that upon accumulation of unfolded proteins in the endoplasmic reticulum (ER), the mRNA of this gene is processed to an active form by an unconventional splicing mechanism that is mediated by the endonuclease inositol-requiring enzyme 1 (IRE1). The resulting loss of 26 nt from the spliced mRNA causes a frame-shift and an isoform XBP1(S), which is the functionally active transcription factor. The isoform encoded by the unspliced mRNA, XBP1(U), is constitutively expressed, and thought to function as a negative feedback regulator of XBP1(S), which shuts off transcription of target genes during the recovery phase of ER stress. A pseudogene of XBP1 has been identified and localized to chromosome 5.
Anti-XBP1 (3F5)
YF-MA16078 100 ug
EUR 363
Description: Mouse monoclonal to XBP1
Anti-XBP1 (1E3)
YF-MA16079 100 ug
EUR 363
Description: Mouse monoclonal to XBP1
Anti-XBP1 (4E4)
YF-MA16080 100 ug
EUR 363
Description: Mouse monoclonal to XBP1
Anti-XBP1 (2D9)
YF-MA16081 100 ug
EUR 363
Description: Mouse monoclonal to XBP1
XBP1 Antibody, HRP conjugated
1-CSB-PA05319B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against XBP1. Recognizes XBP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
XBP1 Antibody, FITC conjugated
1-CSB-PA05319C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against XBP1. Recognizes XBP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
XBP1 Antibody, Biotin conjugated
1-CSB-PA05319D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against XBP1. Recognizes XBP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Human XBP1 ELISA Kit
ELA-E9143h 96 Tests
EUR 824
XBP1 ELISA KIT|Human
EF006484 96 Tests
EUR 689
Rat XBP1 shRNA Plasmid
20-abx988408
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Mouse XBP1 shRNA Plasmid
20-abx973415
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Human XBP1 shRNA Plasmid
20-abx955127
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
XBP1 recombinant monoclonal antibody
A5763 100ul X 3
EUR 595
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human XBP1 for WB,ELISA
XBP1 Recombinant Protein (Rat)
RP237581 100 ug Ask for price