TBCE

TBCE antibody
70R-20717	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal TBCE antibody

TBCE Antibody
1-CSB-PA613603ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TBCE. Recognizes TBCE from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

TBCE Antibody
1-CSB-PA613603ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against TBCE. Recognizes TBCE from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

TBCE Antibody
DF12766	Affbiotech	200ul	EUR 304
Description: TBCE Antibody detects endogenous levels of TBCE.

TBCE Antibody
1-CSB-PA023230GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TBCE. Recognizes TBCE from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

TBCE siRNA
20-abx905479	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TBCE siRNA
20-abx936223	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TBCE siRNA
20-abx936224	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-TBCE
YF-PA14924	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to TBCE

anti-TBCE
YF-PA14925	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to TBCE

anti-TBCE
YF-PA14926	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to TBCE

TBCE Polyclonal Antibody
30929-100ul	SAB	100ul	EUR 252

TBCE Polyclonal Antibody
30929-50ul	SAB	50ul	EUR 187

TBCE Blocking Peptide
DF12766-BP	Affbiotech	1mg	EUR 195

TBCE cloning plasmid
CSB-CL613603HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1584 Sequence: atgagtgacactttgacagcggatgtcattggtcgaagagttgaagttaatggagaacatgcaacagtacgttttgctggtgttgtccctcccgtggcaggaccctggttaggagtagaatgggacaatcccgagagaggaaagcatgatgggagccacgaagggactgtgtatt Show more
Description: A cloning plasmid for the TBCE gene.

TBCE Rabbit pAb
A7453-100ul	Abclonal	100 ul	EUR 308

TBCE Rabbit pAb
A7453-200ul	Abclonal	200 ul	EUR 459

TBCE Rabbit pAb
A7453-20ul	Abclonal	20 ul	EUR 183

TBCE Rabbit pAb
A7453-50ul	Abclonal	50 ul	EUR 223

anti- TBCE antibody
FNab08520	FN Test	100µg	EUR 548.75
Immunogen: tubulin folding cofactor E Uniprot ID: Q15813 Gene ID: 6905 Research Area: Metabolism
Description: Antibody raised against TBCE

Anti-TBCE antibody
PAab08520	Lifescience Market	100 ug	EUR 386

pCMV-SPORT6-TBCE
PVT12918	Lifescience Market	2 ug	EUR 391

Anti-TBCE antibody
STJ29589	St John's Laboratory	100 µl	EUR 277
Description: Cofactor E is one of four proteins (cofactors A, D, E, and C) involved in the pathway leading to correctly folded beta-tubulin from folding intermediates. Cofactors A and D are believed to play a role in capturing and stabilizing beta-tubulin intermediates in a quasi-native confirmation. Cofactor E binds to the cofactor D/beta-tubulin complex; interaction with cofactor C then causes the release of beta-tubulin polypeptides that are committed to the native state. Two transcript variants encoding the same protein have been found for this gene.

TBCE ELISA KIT|Human
EF003472	Lifescience Market	96 Tests	EUR 689

Rat TBCE shRNA Plasmid
20-abx990170	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse TBCE shRNA Plasmid
20-abx977212	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Polyclonal TBCE Antibody (Center)
APR13712G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TBCE (Center). This antibody is tested and proven to work in the following applications:

TBCE Polyclonal Conjugated Antibody
C30929	SAB	100ul	EUR 397

Human TBCE shRNA Plasmid
20-abx954731	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TBCE Recombinant Protein (Rat)
RP232466	ABM	100 ug	Ask for price

TBCE Recombinant Protein (Human)
RP031051	ABM	100 ug	Ask for price

TBCE Recombinant Protein (Mouse)
RP177590	ABM	100 ug	Ask for price

Tbce ORF Vector (Rat) (pORF)
ORF077490	ABM	1.0 ug DNA	EUR 506

TBCE ORF Vector (Human) (pORF)
ORF010351	ABM	1.0 ug DNA	EUR 95

Tbce ORF Vector (Mouse) (pORF)
ORF059198	ABM	1.0 ug DNA	EUR 506

Tubulin-Specific Chaperone E (TBCE) Antibody
20-abx006489	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Tubulin Folding Cofactor E (TBCE) Antibody
20-abx116339	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Tubulin-Specific Chaperone E (TBCE) Antibody
abx036291-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Tubulin-Specific Chaperone E (TBCE) Antibody
abx034466-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Tubulin-Specific Chaperone E (TBCE) Antibody
abx034466-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Tubulin-Specific Chaperone E (TBCE) Antibody
abx238520-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Polyclonal TBCE Antibody - C-terminal region
APR13713G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TBCE - C-terminal region. This antibody is tested and proven to work in the following applications:

Tubulin-Specific Chaperone E (TBCE) Antibody
20-abx321004	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Tubulin-Specific Chaperone E (TBCE) Antibody
20-abx321911	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Tbce sgRNA CRISPR Lentivector set (Rat)
K7246901	ABM	3 x 1.0 ug	EUR 339

TBCE sgRNA CRISPR Lentivector set (Human)
K2342601	ABM	3 x 1.0 ug	EUR 339

Tbce sgRNA CRISPR Lentivector (Rat) (Target 1)
K7246902	ABM	1.0 ug DNA	EUR 154

Tbce sgRNA CRISPR Lentivector (Rat) (Target 2)
K7246903	ABM	1.0 ug DNA	EUR 154

Tbce sgRNA CRISPR Lentivector (Rat) (Target 3)
K7246904	ABM	1.0 ug DNA	EUR 154

TBCE sgRNA CRISPR Lentivector (Human) (Target 1)
K2342602	ABM	1.0 ug DNA	EUR 154

TBCE sgRNA CRISPR Lentivector (Human) (Target 2)
K2342603	ABM	1.0 ug DNA	EUR 154

TBCE sgRNA CRISPR Lentivector (Human) (Target 3)
K2342604	ABM	1.0 ug DNA	EUR 154

TBCE Protein Vector (Rat) (pPB-C-His)
PV309958	ABM	500 ng	EUR 603

TBCE Protein Vector (Rat) (pPB-N-His)
PV309959	ABM	500 ng	EUR 603

TBCE Protein Vector (Rat) (pPM-C-HA)
PV309960	ABM	500 ng	EUR 603

TBCE Protein Vector (Rat) (pPM-C-His)
PV309961	ABM	500 ng	EUR 603

TBCE Protein Vector (Human) (pPB-C-His)
PV041401	ABM	500 ng	EUR 329

TBCE Protein Vector (Human) (pPB-N-His)
PV041402	ABM	500 ng	EUR 329

TBCE Protein Vector (Human) (pPM-C-HA)
PV041403	ABM	500 ng	EUR 329

TBCE Protein Vector (Human) (pPM-C-His)
PV041404	ABM	500 ng	EUR 329

TBCE Protein Vector (Mouse) (pPB-C-His)
PV236790	ABM	500 ng	EUR 603

TBCE Protein Vector (Mouse) (pPB-N-His)
PV236791	ABM	500 ng	EUR 603

TBCE Protein Vector (Mouse) (pPM-C-HA)
PV236792	ABM	500 ng	EUR 603

TBCE Protein Vector (Mouse) (pPM-C-His)
PV236793	ABM	500 ng	EUR 603

Tbce 3'UTR Luciferase Stable Cell Line
TU221651	ABM	1.0 ml	Ask for price

TBCE 3'UTR GFP Stable Cell Line
TU075230	ABM	1.0 ml	EUR 1394

Tbce 3'UTR GFP Stable Cell Line
TU271651	ABM	1.0 ml	Ask for price

TBCE 3'UTR Luciferase Stable Cell Line
TU025230	ABM	1.0 ml	EUR 1394

Mouse Tubulin- specific chaperone E, Tbce ELISA KIT
ELI-17385m	Lifescience Market	96 Tests	EUR 865

Human Tubulin- specific chaperone E, TBCE ELISA KIT
ELI-28987h	Lifescience Market	96 Tests	EUR 824

Bovine Tubulin- specific chaperone E, TBCE ELISA KIT
ELI-52877b	Lifescience Market	96 Tests	EUR 928

Rat Tubulin-specific chaperone E (TBCE) ELISA Kit
abx392083-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Tubulin-specific chaperone E (TBCE) ELISA Kit
abx383650-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Tubulin-specific chaperone E (TBCE) ELISA Kit
abx390801-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

TBCE Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV691303	ABM	1.0 ug DNA	EUR 682