SUMO2

Human Small Ubiquitin Related Modifier Protein 2 (SUMO2) ELISA Kit
DLR-SUMO2-Hu-96T 96T
EUR 673
  • Should the Human Small Ubiquitin Related Modifier Protein 2 (SUMO2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Small Ubiquitin Related Modifier Protein 2 (SUMO2) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Small Ubiquitin Related Modifier Protein 2 (SUMO2) ELISA Kit
RD-SUMO2-Hu-48Tests 48 Tests
EUR 521
Human Small Ubiquitin Related Modifier Protein 2 (SUMO2) ELISA Kit
RD-SUMO2-Hu-96Tests 96 Tests
EUR 723
Human Small Ubiquitin Related Modifier Protein 2 (SUMO2) ELISA Kit
RDR-SUMO2-Hu-48Tests 48 Tests
EUR 544
Human Small Ubiquitin Related Modifier Protein 2 (SUMO2) ELISA Kit
RDR-SUMO2-Hu-96Tests 96 Tests
EUR 756
SUMO2
E541-030 100ug
EUR 343
SUMO2/3 (SUMO2/3) Antibody
20-abx008699
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
SUMO2/3 (SUMO2/3) Antibody
abx026675-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
SUMO2/3 (SUMO2/3) Antibody
abx026675-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
SUMO2/3 (SUMO2/3) Antibody
abx026676-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
SUMO2/3 (SUMO2/3) Antibody
abx026676-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
SUMO2/3 (SUMO2/3) Antibody
abx026683-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
SUMO2/3 (SUMO2/3) Antibody
abx026683-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
SUMO2/3 (SUMO2/3) Antibody
abx238390-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
SUMO2/3 (SUMO2/3) Antibody
abx238391-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.
Sumo2/ Rat Sumo2 ELISA Kit
ELI-52173r 96 Tests
EUR 886
SUMO2 protein
30R-1289 100 ug
EUR 268
Description: Purified recombinant Human SUMO2 protein
SUMO2 protein
30R-2786 100 ug
EUR 336
Description: Purified recombinant Human SUMO2 protein
SUMO2 antibody
70R-20650 50 ul
EUR 435
Description: Rabbit polyclonal SUMO2 antibody
SUMO2 Antibody
32722-100ul 100ul
EUR 252
SUMO2 antibody
38405-100ul 100ul
EUR 252
SUMO2 antibody
10R-1181 100 ul
EUR 316
Description: Mouse monoclonal SUMO2 antibody
SUMO2 Antibody
1-CSB-PA05009A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SUMO2. Recognizes SUMO2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
SUMO2 Antibody
CSB-PA099258-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in pH7.3 PBS, 0.05% NaN3, 50% Glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against SUMO2. Recognizes SUMO2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
SUMO2 Antibody
CSB-PA099258-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in pH7.3 PBS, 0.05% NaN3, 50% Glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against SUMO2. Recognizes SUMO2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
SUMO2 Antibody
DF7024 200ul
EUR 304
Description: SUMO2 Antibody detects endogenous levels of total SUMO2.
SUMO2 Antibody
1-CSB-PA022949GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SUMO2. Recognizes SUMO2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
SUMO2 siRNA
20-abx905375
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SUMO2 siRNA
20-abx935666
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SUMO2 siRNA
20-abx935667
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SUMO2 Antibody
ABD7024 100 ug
EUR 438
pENTR223-SUMO2
PVT12374 2 ug
EUR 391
Human SUMO2/3 (SUMO2/3) ELISA Kit
abx259859-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.
SUMO2/3 Antibody
25117-100ul 100ul
EUR 390
SUMO2/3 antibody
70R-30820 100 ug
EUR 327
Description: Rabbit polyclonal SUMO2/3 antibody
SUMO2/3 antibody
70R-30839 100 ug
EUR 327
Description: Rabbit polyclonal SUMO2/3 antibody
Human SUMO2 Antibody
32621-05111 150 ug
EUR 261
SUMO2, human recombinant
4942-100
EUR 251
SUMO2, human recombinant
4942-1000
EUR 1518
SUMO2 Blocking Peptide
DF7024-BP 1mg
EUR 195
SUMO2/3 antibody
70R-50404 100 ul
EUR 244
Description: Purified Polyclonal SUMO2/3 antibody
Xenopus SUMO2 Antibody
abx027062-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Xenopus SUMO2 Antibody
abx027062-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Human SUMO2 Protein
abx060006-100ug 100 ug
EUR 328
  • Shipped within 5-10 working days.
SUMO2-biotin Protein
E28003 50 µg
EUR 338.55
Description: reagents widely cited
SUMO2 Conjugated Antibody
C32722 100ul
EUR 397
SUMO2 cloning plasmid
CSB-CL022949HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 288
  • Sequence: atggccgacgaaaagcccaaggaaggagtcaagactgagaacaacgatcatattaatttgaaggtggcggggcaggatggttctgtggtgcagtttaagattaagaggcatacaccacttagtaaactaatgaaagcctattgtgaacgacagggattgtcaatgaggcagatcag
  • Show more
Description: A cloning plasmid for the SUMO2 gene.
SUMO2 cloning plasmid
CSB-CL022949HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 288
  • Sequence: atggccgacgaaaagcccaaggaaggagtcaagactgagaacaacaatcatattaatttgaaggtggcggggcaggatggttctgtggtgcagtttaagattaagaggcatacaccacttagtaaactaatgaaagcctattgtgaacgacagggattgtcaatgaggcagatcag
  • Show more
Description: A cloning plasmid for the SUMO2 gene.
SUMO2 Rabbit pAb
A2486-100ul 100 ul
EUR 308
SUMO2 Rabbit pAb
A2486-200ul 200 ul
EUR 459
SUMO2 Rabbit pAb
A2486-20ul 20 ul
EUR 183
SUMO2 Rabbit pAb
A2486-50ul 50 ul
EUR 223
SUMO2 Rabbit pAb
A2571-100ul 100 ul
EUR 308
SUMO2 Rabbit pAb
A2571-200ul 200 ul
EUR 459
SUMO2 Rabbit pAb
A2571-20ul 20 ul
EUR 183
SUMO2 Rabbit pAb
A2571-50ul 50 ul
EUR 223
SUMO2 Rabbit pAb
A1523-100ul 100 ul
EUR 308
SUMO2 Rabbit pAb
A1523-200ul 200 ul
EUR 459
SUMO2 Rabbit pAb
A1523-20ul 20 ul
EUR 183
SUMO2 Rabbit pAb
A1523-50ul 50 ul
EUR 223
SUMO2 Polyclonal Antibody
ABP60553-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human SUMO2 protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of SUMO2 from Human, Mouse, Rat. This SUMO2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SUMO2 protein at amino acid sequence of 10-90
SUMO2 Polyclonal Antibody
ABP60553-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human SUMO2 protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of SUMO2 from Human, Mouse, Rat. This SUMO2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SUMO2 protein at amino acid sequence of 10-90
SUMO2 Polyclonal Antibody
ABP60553-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human SUMO2 protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of SUMO2 from Human, Mouse, Rat. This SUMO2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SUMO2 protein at amino acid sequence of 10-90
SUMO2 Polyclonal Antibody
ES9018-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against SUMO2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
SUMO2 Polyclonal Antibody
ES9018-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against SUMO2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
p3*Flag- SUMO2
PVT10172 2 ug
EUR 301
pWPXLd-SUMO2 Plasmid
PVTB00794-4a 2 ug
EUR 356
Anti-SUMO2 antibody
STJ25749 100 µl
EUR 277
Description: This gene encodes a protein that is a member of the SUMO (small ubiquitin-like modifier) protein family. It functions in a manner similar to ubiquitin in that it is bound to target proteins as part of a post-translational modification system. However, unlike ubiquitin which targets proteins for degradation, this protein is involved in a variety of cellular processes, such as nuclear transport, transcriptional regulation, apoptosis, and protein stability. It is not active until the last two amino acids of the carboxy-terminus have been cleaved off. Numerous pseudogenes have been reported for this gene. Alternate transcriptional splice variants, encoding different isoforms, have been characterized.
Anti-SUMO2 antibody
STJ28142 100 µl
EUR 277
Description: This gene encodes a protein that is a member of the SUMO (small ubiquitin-like modifier) protein family. It functions in a manner similar to ubiquitin in that it is bound to target proteins as part of a post-translational modification system. However, unlike ubiquitin which targets proteins for degradation, this protein is involved in a variety of cellular processes, such as nuclear transport, transcriptional regulation, apoptosis, and protein stability. It is not active until the last two amino acids of the carboxy-terminus have been cleaved off. Numerous pseudogenes have been reported for this gene. Alternate transcriptional splice variants, encoding different isoforms, have been characterized.
Anti-SUMO2 antibody
STJ116151 100 µl
EUR 277
Description: This gene encodes a protein that is a member of the SUMO (small ubiquitin-like modifier) protein family. It functions in a manner similar to ubiquitin in that it is bound to target proteins as part of a post-translational modification system. However, unlike ubiquitin which targets proteins for degradation, this protein is involved in a variety of cellular processes, such as nuclear transport, transcriptional regulation, apoptosis, and protein stability. It is not active until the last two amino acids of the carboxy-terminus have been cleaved off. Numerous pseudogenes have been reported for this gene. Alternate transcriptional splice variants, encoding different isoforms, have been characterized.
Anti-SUMO2 antibody
STJ190176 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to SUMO2
SUMO2/SUMO3/SUMO4 Antibody
36877-100ul 100ul
EUR 252
Sumo2/3/4 Antibody
45466-100ul 100ul
EUR 252
Sumo2/3/4 Antibody
45466-50ul 50ul
EUR 187
Cleaved-SUMO2 (G93) Antibody
1-CSB-PA000062
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Cleaved-SUMO2 (G93). Recognizes Cleaved-SUMO2 (G93) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000