RNF146

RNF146 siRNA

20-abx904608
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RNF146 siRNA

20-abx931701
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RNF146 siRNA

20-abx931702
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RNF146 Antibody

47192-100ul 100ul
EUR 252

RNF146 antibody

70R-1167 100 ug
EUR 377
Description: Rabbit polyclonal RNF146 antibody raised against the C terminal of RNF146

anti-RNF146

YF-PA21189 50 ug
EUR 363
Description: Mouse polyclonal to RNF146

anti-RNF146

YF-PA26675 50 ul
EUR 334
Description: Mouse polyclonal to RNF146

E3 Ubiquitin-Protein Ligase RNF146 (RNF146) Antibody

abx122589-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

RNF146 Conjugated Antibody

C47192 100ul
EUR 397

RNF146 Blocking Peptide

33R-1618 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RNF146 antibody, catalog no. 70R-1167

RNF146 cloning plasmid

CSB-CL889110HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1077
  • Sequence: atggctggctgtggtgaaattgatcattcaataaacatgcttcctacaaacaggaaagcgaacgagtcctgttctaatactgcaccttctttaaccgtccctgaatgtgccatttgtctgcaaacatgtgttcatccagtcagtctgccctgtaagcacgttttctgctatctat
  • Show more
Description: A cloning plasmid for the RNF146 gene.

pCMV-SPORT6-RNF146

PVT13038 2 ug
EUR 266

Human E3 ubiquitin- protein ligase RNF146, RNF146 ELISA KIT

ELI-14510h 96 Tests
EUR 824

Mouse E3 ubiquitin- protein ligase RNF146, Rnf146 ELISA KIT

ELI-30249m 96 Tests
EUR 865

Mouse RNF146 shRNA Plasmid

20-abx976455
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat RNF146 shRNA Plasmid

20-abx989465
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RNF146 shRNA Plasmid

20-abx963061
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RNF146 Recombinant Protein (Human)

RP026614 100 ug Ask for price

RNF146 Recombinant Protein (Rat)

RP226340 100 ug Ask for price

RNF146 Recombinant Protein (Mouse)

RP168515 100 ug Ask for price

RNF146 Recombinant Protein (Mouse)

RP168518 100 ug Ask for price

RNF146 Recombinant Protein (Mouse)

RP168521 100 ug Ask for price

RNF146 Recombinant Protein (Mouse)

RP168524 100 ug Ask for price

RNF146 ORF Vector (Human) (pORF)

ORF008872 1.0 ug DNA
EUR 95

Rnf146 ORF Vector (Mouse) (pORF)

ORF056173 1.0 ug DNA
EUR 506

Rnf146 ORF Vector (Mouse) (pORF)

ORF056174 1.0 ug DNA
EUR 506

Rnf146 ORF Vector (Mouse) (pORF)

ORF056175 1.0 ug DNA
EUR 506

Rnf146 ORF Vector (Mouse) (pORF)

ORF056176 1.0 ug DNA
EUR 506

Rnf146 ORF Vector (Rat) (pORF)

ORF075448 1.0 ug DNA
EUR 506

RNF146 sgRNA CRISPR Lentivector set (Human)

K1839101 3 x 1.0 ug
EUR 339

Rnf146 sgRNA CRISPR Lentivector set (Mouse)

K4668001 3 x 1.0 ug
EUR 339

Rnf146 sgRNA CRISPR Lentivector set (Rat)

K6680501 3 x 1.0 ug
EUR 339

RNF146 sgRNA CRISPR Lentivector (Human) (Target 1)

K1839102 1.0 ug DNA
EUR 154

RNF146 sgRNA CRISPR Lentivector (Human) (Target 2)

K1839103 1.0 ug DNA
EUR 154

RNF146 sgRNA CRISPR Lentivector (Human) (Target 3)

K1839104 1.0 ug DNA
EUR 154

Rnf146 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4668002 1.0 ug DNA
EUR 154

Rnf146 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4668003 1.0 ug DNA
EUR 154

Rnf146 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4668004 1.0 ug DNA
EUR 154

Rnf146 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6680502 1.0 ug DNA
EUR 154

Rnf146 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6680503 1.0 ug DNA
EUR 154

Rnf146 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6680504 1.0 ug DNA
EUR 154

Recombinant human E3 ubiquitin-protein ligase RNF146

P1753 100ug Ask for price
  • Uniprot ID: Q9NTX7
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human E3 ubiquitin-protein ligase RNF146

RNF146 Protein Vector (Human) (pPB-C-His)

PV035485 500 ng
EUR 329

RNF146 Protein Vector (Human) (pPB-N-His)

PV035486 500 ng
EUR 329

RNF146 Protein Vector (Human) (pPM-C-HA)

PV035487 500 ng
EUR 329

RNF146 Protein Vector (Human) (pPM-C-His)

PV035488 500 ng
EUR 329

RNF146 Protein Vector (Rat) (pPB-C-His)

PV301790 500 ng
EUR 603

RNF146 Protein Vector (Rat) (pPB-N-His)

PV301791 500 ng
EUR 603

RNF146 Protein Vector (Rat) (pPM-C-HA)

PV301792 500 ng
EUR 603

RNF146 Protein Vector (Rat) (pPM-C-His)

PV301793 500 ng
EUR 603

RNF146 Protein Vector (Mouse) (pPB-C-His)

PV224690 500 ng
EUR 603

RNF146 Protein Vector (Mouse) (pPB-N-His)

PV224691 500 ng
EUR 603

RNF146 Protein Vector (Mouse) (pPM-C-HA)

PV224692 500 ng
EUR 603

RNF146 Protein Vector (Mouse) (pPM-C-His)

PV224693 500 ng
EUR 603

RNF146 Protein Vector (Mouse) (pPB-C-His)

PV224694 500 ng
EUR 603

RNF146 Protein Vector (Mouse) (pPB-N-His)

PV224695 500 ng
EUR 603

RNF146 Protein Vector (Mouse) (pPM-C-HA)

PV224696 500 ng
EUR 603

RNF146 Protein Vector (Mouse) (pPM-C-His)

PV224697 500 ng
EUR 603

RNF146 Protein Vector (Mouse) (pPB-C-His)

PV224698 500 ng
EUR 603

RNF146 Protein Vector (Mouse) (pPB-N-His)

PV224699 500 ng
EUR 603

RNF146 Protein Vector (Mouse) (pPM-C-HA)

PV224700 500 ng
EUR 603

RNF146 Protein Vector (Mouse) (pPM-C-His)

PV224701 500 ng
EUR 603

RNF146 Protein Vector (Mouse) (pPB-C-His)

PV224702 500 ng
EUR 603

RNF146 Protein Vector (Mouse) (pPB-N-His)

PV224703 500 ng
EUR 603

RNF146 Protein Vector (Mouse) (pPM-C-HA)

PV224704 500 ng
EUR 603

RNF146 Protein Vector (Mouse) (pPM-C-His)

PV224705 500 ng
EUR 603

Rnf146 3'UTR GFP Stable Cell Line

TU167967 1.0 ml Ask for price

RNF146 3'UTR Luciferase Stable Cell Line

TU020075 1.0 ml
EUR 1394

Rnf146 3'UTR Luciferase Stable Cell Line

TU117967 1.0 ml Ask for price

RNF146 3'UTR GFP Stable Cell Line

TU070075 1.0 ml
EUR 1394

Rnf146 3'UTR Luciferase Stable Cell Line

TU219520 1.0 ml Ask for price

Rnf146 3'UTR GFP Stable Cell Line

TU269520 1.0 ml Ask for price

RNF146 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV665101 1.0 ug DNA
EUR 682

RNF146 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV665105 1.0 ug DNA
EUR 682

RNF146 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV665106 1.0 ug DNA
EUR 682

Bovine E3 ubiquitin- protein ligase RNF146- A, RNF146A ELISA KIT

ELI-15079b 96 Tests
EUR 928

Bovine E3 ubiquitin- protein ligase RNF146- B, RNF146B ELISA KIT

ELI-44460b 96 Tests
EUR 928

RNF146 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1839105 3 x 1.0 ug
EUR 376

Rnf146 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4668005 3 x 1.0 ug
EUR 376

Rnf146 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6680505 3 x 1.0 ug
EUR 376

RNF146 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1839106 1.0 ug DNA
EUR 167

RNF146 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1839107 1.0 ug DNA
EUR 167

RNF146 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1839108 1.0 ug DNA
EUR 167

Rnf146 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4668006 1.0 ug DNA
EUR 167

Rnf146 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4668007 1.0 ug DNA
EUR 167