RNF146

RNF146 siRNA
20-abx904608	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RNF146 siRNA
20-abx931701	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RNF146 siRNA
20-abx931702	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RNF146 Antibody
47192-100ul	SAB	100ul	EUR 252

RNF146 antibody
70R-1167	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal RNF146 antibody raised against the C terminal of RNF146

anti-RNF146
YF-PA21189	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to RNF146

anti-RNF146
YF-PA26675	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to RNF146

E3 Ubiquitin-Protein Ligase RNF146 (RNF146) Antibody
abx122589-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

RNF146 Conjugated Antibody
C47192	SAB	100ul	EUR 397

RNF146 Blocking Peptide
33R-1618	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RNF146 antibody, catalog no. 70R-1167

RNF146 cloning plasmid
CSB-CL889110HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1077 Sequence: atggctggctgtggtgaaattgatcattcaataaacatgcttcctacaaacaggaaagcgaacgagtcctgttctaatactgcaccttctttaaccgtccctgaatgtgccatttgtctgcaaacatgtgttcatccagtcagtctgccctgtaagcacgttttctgctatctat Show more
Description: A cloning plasmid for the RNF146 gene.

pCMV-SPORT6-RNF146
PVT13038	Lifescience Market	2 ug	EUR 266

Human E3 ubiquitin- protein ligase RNF146, RNF146 ELISA KIT
ELI-14510h	Lifescience Market	96 Tests	EUR 824

Mouse E3 ubiquitin- protein ligase RNF146, Rnf146 ELISA KIT
ELI-30249m	Lifescience Market	96 Tests	EUR 865

Mouse RNF146 shRNA Plasmid
20-abx976455	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat RNF146 shRNA Plasmid
20-abx989465	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human RNF146 shRNA Plasmid
20-abx963061	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RNF146 Recombinant Protein (Human)
RP026614	ABM	100 ug	Ask for price

RNF146 Recombinant Protein (Rat)
RP226340	ABM	100 ug	Ask for price

RNF146 Recombinant Protein (Mouse)
RP168515	ABM	100 ug	Ask for price

RNF146 Recombinant Protein (Mouse)
RP168518	ABM	100 ug	Ask for price

RNF146 Recombinant Protein (Mouse)
RP168521	ABM	100 ug	Ask for price

RNF146 Recombinant Protein (Mouse)
RP168524	ABM	100 ug	Ask for price

RNF146 ORF Vector (Human) (pORF)
ORF008872	ABM	1.0 ug DNA	EUR 95

Rnf146 ORF Vector (Mouse) (pORF)
ORF056173	ABM	1.0 ug DNA	EUR 506

Rnf146 ORF Vector (Mouse) (pORF)
ORF056174	ABM	1.0 ug DNA	EUR 506

Rnf146 ORF Vector (Mouse) (pORF)
ORF056175	ABM	1.0 ug DNA	EUR 506

Rnf146 ORF Vector (Mouse) (pORF)
ORF056176	ABM	1.0 ug DNA	EUR 506

Rnf146 ORF Vector (Rat) (pORF)
ORF075448	ABM	1.0 ug DNA	EUR 506

RNF146 sgRNA CRISPR Lentivector set (Human)
K1839101	ABM	3 x 1.0 ug	EUR 339

Rnf146 sgRNA CRISPR Lentivector set (Mouse)
K4668001	ABM	3 x 1.0 ug	EUR 339

Rnf146 sgRNA CRISPR Lentivector set (Rat)
K6680501	ABM	3 x 1.0 ug	EUR 339

RNF146 sgRNA CRISPR Lentivector (Human) (Target 1)
K1839102	ABM	1.0 ug DNA	EUR 154

RNF146 sgRNA CRISPR Lentivector (Human) (Target 2)
K1839103	ABM	1.0 ug DNA	EUR 154

RNF146 sgRNA CRISPR Lentivector (Human) (Target 3)
K1839104	ABM	1.0 ug DNA	EUR 154

Rnf146 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4668002	ABM	1.0 ug DNA	EUR 154

Rnf146 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4668003	ABM	1.0 ug DNA	EUR 154

Rnf146 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4668004	ABM	1.0 ug DNA	EUR 154

Rnf146 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6680502	ABM	1.0 ug DNA	EUR 154

Rnf146 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6680503	ABM	1.0 ug DNA	EUR 154

Rnf146 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6680504	ABM	1.0 ug DNA	EUR 154

Recombinant human E3 ubiquitin-protein ligase RNF146
P1753	FN Test	100ug	Ask for price
Uniprot ID: Q9NTX7 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human E3 ubiquitin-protein ligase RNF146

RNF146 Protein Vector (Human) (pPB-C-His)
PV035485	ABM	500 ng	EUR 329

RNF146 Protein Vector (Human) (pPB-N-His)
PV035486	ABM	500 ng	EUR 329

RNF146 Protein Vector (Human) (pPM-C-HA)
PV035487	ABM	500 ng	EUR 329

RNF146 Protein Vector (Human) (pPM-C-His)
PV035488	ABM	500 ng	EUR 329

RNF146 Protein Vector (Rat) (pPB-C-His)
PV301790	ABM	500 ng	EUR 603

RNF146 Protein Vector (Rat) (pPB-N-His)
PV301791	ABM	500 ng	EUR 603

RNF146 Protein Vector (Rat) (pPM-C-HA)
PV301792	ABM	500 ng	EUR 603

RNF146 Protein Vector (Rat) (pPM-C-His)
PV301793	ABM	500 ng	EUR 603

RNF146 Protein Vector (Mouse) (pPB-C-His)
PV224690	ABM	500 ng	EUR 603

RNF146 Protein Vector (Mouse) (pPB-N-His)
PV224691	ABM	500 ng	EUR 603

RNF146 Protein Vector (Mouse) (pPM-C-HA)
PV224692	ABM	500 ng	EUR 603

RNF146 Protein Vector (Mouse) (pPM-C-His)
PV224693	ABM	500 ng	EUR 603

RNF146 Protein Vector (Mouse) (pPB-C-His)
PV224694	ABM	500 ng	EUR 603

RNF146 Protein Vector (Mouse) (pPB-N-His)
PV224695	ABM	500 ng	EUR 603

RNF146 Protein Vector (Mouse) (pPM-C-HA)
PV224696	ABM	500 ng	EUR 603

RNF146 Protein Vector (Mouse) (pPM-C-His)
PV224697	ABM	500 ng	EUR 603

RNF146 Protein Vector (Mouse) (pPB-C-His)
PV224698	ABM	500 ng	EUR 603

RNF146 Protein Vector (Mouse) (pPB-N-His)
PV224699	ABM	500 ng	EUR 603

RNF146 Protein Vector (Mouse) (pPM-C-HA)
PV224700	ABM	500 ng	EUR 603

RNF146 Protein Vector (Mouse) (pPM-C-His)
PV224701	ABM	500 ng	EUR 603

RNF146 Protein Vector (Mouse) (pPB-C-His)
PV224702	ABM	500 ng	EUR 603

RNF146 Protein Vector (Mouse) (pPB-N-His)
PV224703	ABM	500 ng	EUR 603

RNF146 Protein Vector (Mouse) (pPM-C-HA)
PV224704	ABM	500 ng	EUR 603

RNF146 Protein Vector (Mouse) (pPM-C-His)
PV224705	ABM	500 ng	EUR 603

Rnf146 3'UTR GFP Stable Cell Line
TU167967	ABM	1.0 ml	Ask for price

RNF146 3'UTR Luciferase Stable Cell Line
TU020075	ABM	1.0 ml	EUR 1394

Rnf146 3'UTR Luciferase Stable Cell Line
TU117967	ABM	1.0 ml	Ask for price

RNF146 3'UTR GFP Stable Cell Line
TU070075	ABM	1.0 ml	EUR 1394

Rnf146 3'UTR Luciferase Stable Cell Line
TU219520	ABM	1.0 ml	Ask for price

Rnf146 3'UTR GFP Stable Cell Line
TU269520	ABM	1.0 ml	Ask for price

RNF146 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV665101	ABM	1.0 ug DNA	EUR 682

RNF146 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV665105	ABM	1.0 ug DNA	EUR 682

RNF146 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV665106	ABM	1.0 ug DNA	EUR 682

Bovine E3 ubiquitin- protein ligase RNF146- A, RNF146A ELISA KIT
ELI-15079b	Lifescience Market	96 Tests	EUR 928

Bovine E3 ubiquitin- protein ligase RNF146- B, RNF146B ELISA KIT
ELI-44460b	Lifescience Market	96 Tests	EUR 928

RNF146 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1839105	ABM	3 x 1.0 ug	EUR 376

Rnf146 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4668005	ABM	3 x 1.0 ug	EUR 376

Rnf146 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6680505	ABM	3 x 1.0 ug	EUR 376

RNF146 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1839106	ABM	1.0 ug DNA	EUR 167

RNF146 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1839107	ABM	1.0 ug DNA	EUR 167

RNF146 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1839108	ABM	1.0 ug DNA	EUR 167

Rnf146 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4668006	ABM	1.0 ug DNA	EUR 167

Rnf146 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4668007	ABM	1.0 ug DNA	EUR 167