Human ISL LIM Homeobox Protein 1 (ISL1) ELISA Kit

DLR-ISL1-Hu-96T 96T
EUR 673
  • Should the Human ISL LIM Homeobox Protein 1 (ISL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human ISL LIM Homeobox Protein 1 (ISL1) in samples from tissue homogenates or other biological fluids.

Human ISL LIM Homeobox Protein 1 (ISL1) ELISA Kit

RDR-ISL1-Hu-48Tests 48 Tests
EUR 544

Human ISL LIM Homeobox Protein 1 (ISL1) ELISA Kit

RDR-ISL1-Hu-96Tests 96 Tests
EUR 756

Human ISL LIM Homeobox Protein 1 (ISL1) ELISA Kit

RD-ISL1-Hu-48Tests 48 Tests
EUR 521

Human ISL LIM Homeobox Protein 1 (ISL1) ELISA Kit

RD-ISL1-Hu-96Tests 96 Tests
EUR 723

Isl1/ Rat Isl1 ELISA Kit

ELI-43709r 96 Tests
EUR 886

ISL1 antibody

70R-18016 50 ul
EUR 435
Description: Rabbit polyclonal ISL1 antibody

ISL1 antibody

38866-100ul 100ul
EUR 252

ISL1 antibody

10R-2055 100 ul
EUR 435
Description: Mouse monoclonal ISL1 antibody

ISL1 antibody

10R-2056 100 ul
EUR 403
Description: Mouse monoclonal ISL1 antibody

ISL1 Antibody

DF2537 200ul
EUR 304
Description: ISL1 antibody detects endogenous levels of total ISL1.

ISL1 Antibody

BF0164 200ul
EUR 376
Description: ISL1 antibody detects endogenous levels of total ISL1.

ISL1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ISL1. Recognizes ISL1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

isl1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against isl1. Recognizes isl1 from Zebrafish. This antibody is Unconjugated. Tested in the following application: ELISA

ISL1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ISL1. Recognizes ISL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ISL1 Antibody

ABD13129 100 ug
EUR 438

ISL1 Antibody

ABD2537 100 ug
EUR 438


PVT18815 2 ug
EUR 231

ISL1 Blocking Peptide

DF2537-BP 1mg
EUR 195

ISL1 Conjugated Antibody

C38866 100ul
EUR 397

ISL1 Blocking Peptide

BF0164-BP 1mg
EUR 195

ISL1 cloning plasmid

CSB-CL011846HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1050
  • Sequence: atgggagacatgggagatccaccaaaaaaaaaacgtctgatttccctatgtgttggttgcggcaatcagattcacgatcagtatattctgagggtttctccggatttggaatggcatgcggcatgtttgaaatgtgcggagtgtaatcagtatttggacgagagctgtacatgct
  • Show more
Description: A cloning plasmid for the ISL1 gene.

ISL1 Rabbit pAb

A6383-100ul 100 ul
EUR 308

ISL1 Rabbit pAb

A6383-200ul 200 ul
EUR 459

ISL1 Rabbit pAb

A6383-20ul 20 ul
EUR 183

ISL1 Rabbit pAb

A6383-50ul 50 ul
EUR 223

ISL1 Rabbit pAb

A5245-100ul 100 ul
EUR 308

ISL1 Rabbit pAb

A5245-200ul 200 ul
EUR 459

ISL1 Rabbit pAb

A5245-20ul 20 ul
EUR 183

ISL1 Rabbit pAb

A5245-50ul 50 ul
EUR 223

anti-ISL1 (1H9)

LF-MA30284 100 ul
EUR 537
Description: Mouse Monoclonal to ISL1

anti-ISL1 (1B1)

LF-MA30285 100 ul
EUR 486
Description: Mouse Monoclonal to ISL1

Anti-ISL1 antibody

STJ28466 100 µl
EUR 277
Description: This gene encodes a member of the LIM/homeodomain family of transcription factors. The encoded protein binds to the enhancer region of the insulin gene, among others, and may play an important role in regulating insulin gene expression. The encoded protein is central to the development of pancreatic cell lineages and may also be required for motor neuron generation. Mutations in this gene have been associated with maturity-onset diabetes of the young.

Anti-ISL1 antibody

STJ116276 100 µl
EUR 277
Description: This gene encodes a member of the LIM/homeodomain family of transcription factors. The encoded protein binds to the enhancer region of the insulin gene, among others, and may play an important role in regulating insulin gene expression. The encoded protein is central to the development of pancreatic cell lineages and may also be required for motor neuron generation. Mutations in this gene have been associated with maturity-onset diabetes of the young.

Rat ISL1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

isl1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against isl1. Recognizes isl1 from Zebrafish. This antibody is HRP conjugated. Tested in the following application: ELISA

ISL1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ISL1. Recognizes ISL1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

isl1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against isl1. Recognizes isl1 from Zebrafish. This antibody is FITC conjugated. Tested in the following application: ELISA

ISL1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ISL1. Recognizes ISL1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

isl1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against isl1. Recognizes isl1 from Zebrafish. This antibody is Biotin conjugated. Tested in the following application: ELISA

ISL1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ISL1. Recognizes ISL1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human ISL1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse ISL1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ISL1 Recombinant Protein (Human)

RP016351 100 ug Ask for price

ISL1 Recombinant Protein (Rat)

RP206306 100 ug Ask for price

ISL1 Recombinant Protein (Mouse)

RP144302 100 ug Ask for price

Anti-Islet 1/ISL1 Antibody

A02969-1 100ug/vial
EUR 334

Monoclonal ISL1 Antibody, Clone: 1H9

AMM02714G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human ISL1. The antibodies are raised in Mouse and are from clone 1H9. This antibody is applicable in WB and IHC, ICC, E

Isl1 ORF Vector (Rat) (pORF)

ORF068770 1.0 ug DNA
EUR 506

ISL1 ORF Vector (Human) (pORF)

ORF005451 1.0 ug DNA
EUR 95

Isl1 ORF Vector (Mouse) (pORF)

ORF048102 1.0 ug DNA
EUR 506

pECMV-Isl1-m-FLAG Plasmid

PVT14923 2 ug
EUR 325

ISL1 ELISA Kit (Human) (OKDD00346)

OKDD00346 96 Wells
EUR 975
Description: Description of target: This gene encodes a member of the LIM/homeodomain family of transcription factors. The encoded protein binds to the enhancer region of the insulin gene, among others, and may play an important role in regulating insulin gene expression. The encoded protein is central to the development of pancreatic cell lineages and may also be required for motor neuron generation. Mutations in this gene have been associated with maturity-onset diabetes of the young.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.063 ng/mL

Polyclonal Mouse Isl1 Antibody (C-term)

AMM06443G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Mouse Isl1 (C-term). This antibody is tested and proven to work in the following applications:

Isl1 sgRNA CRISPR Lentivector set (Rat)

K7071401 3 x 1.0 ug
EUR 339

Isl1 sgRNA CRISPR Lentivector set (Mouse)

K4510501 3 x 1.0 ug
EUR 339

ISL1 sgRNA CRISPR Lentivector set (Human)

K1101501 3 x 1.0 ug
EUR 339