Cx3Cr1

Human Chemokine C-X3-C-Motif Receptor 1 (CX3CR1) ELISA Kit

DLR-CX3CR1-Hu-96T 96T
EUR 647
  • Should the Human Chemokine C-X3-C-Motif Receptor 1 (CX3CR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Chemokine C-X3-C-Motif Receptor 1 (CX3CR1) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Chemokine C-X3-C-Motif Receptor 1 (CX3CR1) ELISA Kit

DLR-CX3CR1-Mu-48T 48T
EUR 508
  • Should the Mouse Chemokine C-X3-C-Motif Receptor 1 (CX3CR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Chemokine C-X3-C-Motif Receptor 1 (CX3CR1) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Chemokine C-X3-C-Motif Receptor 1 (CX3CR1) ELISA Kit

DLR-CX3CR1-Mu-96T 96T
EUR 661
  • Should the Mouse Chemokine C-X3-C-Motif Receptor 1 (CX3CR1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Chemokine C-X3-C-Motif Receptor 1 (CX3CR1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Chemokine C-X3-C-Motif Receptor 1 (CX3CR1) ELISA Kit

RDR-CX3CR1-Hu-48Tests 48 Tests
EUR 522

Human Chemokine C-X3-C-Motif Receptor 1 (CX3CR1) ELISA Kit

RDR-CX3CR1-Hu-96Tests 96 Tests
EUR 724

Mouse Chemokine C-X3-C-Motif Receptor 1 (CX3CR1) ELISA Kit

RDR-CX3CR1-Mu-48Tests 48 Tests
EUR 534

Mouse Chemokine C-X3-C-Motif Receptor 1 (CX3CR1) ELISA Kit

RDR-CX3CR1-Mu-96Tests 96 Tests
EUR 742

Human Chemokine C-X3-C-Motif Receptor 1 (CX3CR1) ELISA Kit

RD-CX3CR1-Hu-48Tests 48 Tests
EUR 500

Human Chemokine C-X3-C-Motif Receptor 1 (CX3CR1) ELISA Kit

RD-CX3CR1-Hu-96Tests 96 Tests
EUR 692

Mouse Chemokine C-X3-C-Motif Receptor 1 (CX3CR1) ELISA Kit

RD-CX3CR1-Mu-48Tests 48 Tests
EUR 511

Mouse Chemokine C-X3-C-Motif Receptor 1 (CX3CR1) ELISA Kit

RD-CX3CR1-Mu-96Tests 96 Tests
EUR 709

Cx3cr1/ Rat Cx3cr1 ELISA Kit

ELI-05022r 96 Tests
EUR 886

CX3CR1 siRNA

20-abx901346
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CX3CR1 siRNA

20-abx913229
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CX3CR1 siRNA

20-abx913230
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CX3CR1 antibody

70R-30895 100 ug
EUR 327
Description: Rabbit polyclonal CX3CR1 antibody

CX3CR1 Antibody

ABD2325 100 ug
EUR 438

CX3CR1 Antibody

ABD7096 100 ug
EUR 438

CX3CR1 Antibody

36817-100ul 100ul
EUR 252

CX3CR1 antibody

38481-100ul 100ul
EUR 252

CX3CR1 Antibody

24056-100ul 100ul
EUR 390

CX3CR1 Antibody

24082-100ul 100ul
EUR 390

CX3CR1 antibody

70R-12357 100 ug
EUR 403
Description: Rabbit polyclonal CX3CR1 antibody

CX3CR1 antibody

70R-16679 50 ul
EUR 435
Description: Rabbit polyclonal CX3CR1 antibody

CX3CR1 Antibody

DF7096 200ul
EUR 304
Description: CX3CR1 Antibody detects endogenous levels of total CX3CR1.

CX3CR1 Antibody

DF2325 200ul
EUR 304
Description: CX3CR1 antibody detects endogenous levels of total CX3CR1.

CX3CR1 Antibody

1-CSB-PA004776
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CX3CR1. Recognizes CX3CR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

CX3CR1 Antibody

1-CSB-PA006236GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CX3CR1. Recognizes CX3CR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CX3CR1 Antibody

1-CSB-PA006236LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CX3CR1. Recognizes CX3CR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

CX3CR1 Antibody

1-CSB-PA007487
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CX3CR1. Recognizes CX3CR1 from Human. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

CX3CR1 Antibody

1-CSB-PA135132
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CX3CR1. Recognizes CX3CR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:500-1:2000

CX3CR1 Antibody

1-CSB-PA080771
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CX3CR1. Recognizes CX3CR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000

CX3CR1 antibody

PAab10034 100 ug
EUR 386

anti-CX3CR1

YF-PA11219 50 ug
EUR 363
Description: Mouse polyclonal to CX3CR1

CX3CR1 Conjugated Antibody

C36817 100ul
EUR 397

CX3CR1 Conjugated Antibody

C38481 100ul
EUR 397

Polyclonal CX3CR1 Antibody

APR06242G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CX3CR1 . This antibody is tested and proven to work in the following applications:

Polyclonal CX3CR1 Antibody

APR06258G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CX3CR1 . This antibody is tested and proven to work in the following applications:

CX3CR1 cloning plasmid

CSB-CL006236HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1068
  • Sequence: atggatcagttccctgaatcagtgacagaaaactttgagtacgatgatttggctgaggcctgttatattggggacatcgtggtctttgggactgtgttcctgtccatattctactccgtcatctttgccattggcctggtgggaaatttgttggtagtgtttgccctcaccaaca
  • Show more
Description: A cloning plasmid for the CX3CR1 gene.

anti- CX3CR1 antibody

FNab02090 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:20-1:200
  • Immunogen: chemokine(C-X3-C motif) receptor 1
  • Uniprot ID: P49238
  • Gene ID: 1524
  • Research Area: Neuroscience, Stem Cells, Immunology, Signal Transduction
Description: Antibody raised against CX3CR1

anti- CX3CR1 antibody

FNab10034 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: chemokine(C-X3-C motif) receptor 1
  • Uniprot ID: P49238
  • Gene ID: 1524
  • Research Area: Neuroscience, Stem Cells, Immunology, Signal Transduction
Description: Antibody raised against CX3CR1

CX3CR1 Polyclonal Antibody

ES4914-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CX3CR1 from Human. This antibody is tested and validated for IHC, IF, WB, ELISA

CX3CR1 Polyclonal Antibody

ES4914-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CX3CR1 from Human. This antibody is tested and validated for IHC, IF, WB, ELISA

CX3CR1 Polyclonal Antibody

ABP53915-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human CX3CR1 at AA rangle: 270-350
  • Applications tips:
Description: A polyclonal antibody for detection of CX3CR1 from Human. This CX3CR1 antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human CX3CR1 at AA rangle: 270-350

CX3CR1 Polyclonal Antibody

ABP53915-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human CX3CR1 at AA rangle: 270-350
  • Applications tips:
Description: A polyclonal antibody for detection of CX3CR1 from Human. This CX3CR1 antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human CX3CR1 at AA rangle: 270-350

CX3CR1 Polyclonal Antibody

ABP53915-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human CX3CR1 at AA rangle: 270-350
  • Applications tips:
Description: A polyclonal antibody for detection of CX3CR1 from Human. This CX3CR1 antibody is for IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human CX3CR1 at AA rangle: 270-350

CX3CR1 Rabbit pAb

A2890-100ul 100 ul
EUR 308

CX3CR1 Rabbit pAb

A2890-200ul 200 ul
EUR 459

CX3CR1 Rabbit pAb

A2890-20ul 20 ul
EUR 183

CX3CR1 Rabbit pAb

A2890-50ul 50 ul
EUR 223

CX3CR1 Blocking Peptide

33R-11045 50 ug
EUR 191
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CX3CR1 antibody, catalog no. 70R-12357

CX3CR1 antibody (biotin)

61R-1649 100 ug
EUR 478
Description: Rat monoclonal CX3CR1 antibody (biotin)

CX3CR1/RBS11 Antibody

5537R-100
EUR 316

CX3CR1/RBS11 Antibody

5537R-30T
EUR 146

CX3CR1 Blocking Peptide

DF7096-BP 1mg
EUR 195

CX3CR1 Blocking Peptide

DF2325-BP 1mg
EUR 195

Anti-CX3CR1 antibody

PAab02090 100 ug
EUR 355

Anti-CX3CR1 antibody

STJ92525 200 µl
EUR 197
Description: Rabbit polyclonal to CX3CR1.

Anti-CX3CR1 antibody

STJ23295 100 µl
EUR 277
Description: Fractalkine is a transmembrane protein and chemokine involved in the adhesion and migration of leukocytes. The protein encoded by this gene is a receptor for fractalkine. The encoded protein also is a coreceptor for HIV-1, and some variations in this gene lead to increased susceptibility to HIV-1 infection and rapid progression to AIDS. Four transcript variants encoding two different isoforms have been found for this gene.

Anti-CX3CR1 (2B11)

YF-MA10217 100 ug
EUR 363
Description: Mouse monoclonal to CX3CR1

Anti-CX3CR1 (10D5)

YF-MA10218 100 ug
EUR 363
Description: Mouse monoclonal to CX3CR1

Polyclonal CX3CR1/RBS11 Antibody

APR00286G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CX3CR1/RBS11 . This antibody is tested and proven to work in the following applications:

Rat CX3CR1 shRNA Plasmid

20-abx987662
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CX3CR1 ELISA Kit

EHC0345 96Tests
EUR 521

Human CX3CR1 ELISA Kit

ELA-E1523h 96 Tests
EUR 824

Goat CX3CR1 ELISA Kit

EGTC0345 96Tests
EUR 521

Canine CX3CR1 ELISA Kit

ECC0345 96Tests
EUR 521

Chicken CX3CR1 ELISA Kit

ECKC0345 96Tests
EUR 521

Bovine CX3CR1 ELISA Kit

EBC0345 96Tests
EUR 521

Anserini CX3CR1 ELISA Kit

EAC0345 96Tests
EUR 521