CCDC60 antibody

70R-4198 50 ug
EUR 467
Description: Rabbit polyclonal CCDC60 antibody raised against the C terminal of CCDC60


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CCDC60 Blocking Peptide

33R-8088 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CCDC60 antibody, catalog no. 70R-4198

CCDC60 cloning plasmid

CSB-CL818242HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1653
  • Sequence: atgaccaaggttccagccaccaagaagcttcagagttcccccaactcgggggctgtccggcccttttatgcctcggagaacctaaggcaggtcccagacaagccaatgaagagcatcaagtatatggacaaggaaataataaacctcaaaaaggaccttatacgaagccgctttt
  • Show more
Description: A cloning plasmid for the CCDC60 gene.


ELI-10788h 96 Tests
EUR 824

Rat CCDC60 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CCDC60 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CCDC60 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse Ccdc60 ELISA KIT

ELI-50896m 96 Tests
EUR 865

CCDC60 Recombinant Protein (Human)

RP006001 100 ug Ask for price

CCDC60 Recombinant Protein (Rat)

RP193517 100 ug Ask for price

CCDC60 Recombinant Protein (Mouse)

RP121853 100 ug Ask for price

Ccdc60 ORF Vector (Rat) (pORF)

ORF064507 1.0 ug DNA
EUR 506

CCDC60 ORF Vector (Human) (pORF)

ORF002001 1.0 ug DNA
EUR 95

Ccdc60 ORF Vector (Mouse) (pORF)

ORF040619 1.0 ug DNA
EUR 506

CCDC60 sgRNA CRISPR Lentivector set (Human)

K0377801 3 x 1.0 ug
EUR 339

Ccdc60 sgRNA CRISPR Lentivector set (Rat)

K7510801 3 x 1.0 ug
EUR 339

Ccdc60 sgRNA CRISPR Lentivector set (Mouse)

K3628601 3 x 1.0 ug
EUR 339

CCDC60 sgRNA CRISPR Lentivector (Human) (Target 1)

K0377802 1.0 ug DNA
EUR 154

CCDC60 sgRNA CRISPR Lentivector (Human) (Target 2)

K0377803 1.0 ug DNA
EUR 154

CCDC60 sgRNA CRISPR Lentivector (Human) (Target 3)

K0377804 1.0 ug DNA
EUR 154

Ccdc60 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7510802 1.0 ug DNA
EUR 154

Ccdc60 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7510803 1.0 ug DNA
EUR 154

Ccdc60 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7510804 1.0 ug DNA
EUR 154

Ccdc60 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3628602 1.0 ug DNA
EUR 154

Ccdc60 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3628603 1.0 ug DNA
EUR 154

Ccdc60 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3628604 1.0 ug DNA
EUR 154

CCDC60 Protein Vector (Mouse) (pPB-C-His)

PV162474 500 ng
EUR 603

CCDC60 Protein Vector (Mouse) (pPB-N-His)

PV162475 500 ng
EUR 603

CCDC60 Protein Vector (Mouse) (pPM-C-HA)

PV162476 500 ng
EUR 603

CCDC60 Protein Vector (Mouse) (pPM-C-His)

PV162477 500 ng
EUR 603

CCDC60 Protein Vector (Rat) (pPB-C-His)

PV258026 500 ng
EUR 603

CCDC60 Protein Vector (Rat) (pPB-N-His)

PV258027 500 ng
EUR 603

CCDC60 Protein Vector (Rat) (pPM-C-HA)

PV258028 500 ng
EUR 603

CCDC60 Protein Vector (Rat) (pPM-C-His)

PV258029 500 ng
EUR 603

CCDC60 Protein Vector (Human) (pPB-C-His)

PV008001 500 ng
EUR 329

CCDC60 Protein Vector (Human) (pPB-N-His)

PV008002 500 ng
EUR 329

CCDC60 Protein Vector (Human) (pPM-C-HA)

PV008003 500 ng
EUR 329

CCDC60 Protein Vector (Human) (pPM-C-His)

PV008004 500 ng
EUR 329

Ccdc60 3'UTR GFP Stable Cell Line

TU153315 1.0 ml Ask for price

Ccdc60 3'UTR Luciferase Stable Cell Line

TU103315 1.0 ml Ask for price

Ccdc60 3'UTR Luciferase Stable Cell Line

TU201812 1.0 ml Ask for price

Ccdc60 3'UTR GFP Stable Cell Line

TU251812 1.0 ml Ask for price

CCDC60 3'UTR GFP Stable Cell Line

TU053635 1.0 ml
EUR 1394

CCDC60 3'UTR Luciferase Stable Cell Line

TU003635 1.0 ml
EUR 1394

Coiled Coil Domain Containing Protein 60 (CCDC60) Antibody

  • EUR 328.00
  • EUR 133.00
  • EUR 899.00
  • EUR 467.00
  • EUR 286.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Coiled Coil Domain Containing Protein 60 (CCDC60) Antibody

  • EUR 481.00
  • EUR 133.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Coiled Coil Domain Containing Protein 60 (CCDC60) Antibody

  • EUR 398.00
  • EUR 982.00
  • EUR 495.00
  • EUR 154.00
  • EUR 286.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-7 working days.

Coiled Coil Domain Containing Protein 60 (CCDC60) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

CCDC60 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV658747 1.0 ug DNA
EUR 682

CCDC60 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV658751 1.0 ug DNA
EUR 682

CCDC60 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV658752 1.0 ug DNA
EUR 682

Recombinant Coiled Coil Domain Containing Protein 60 (CCDC60)

  • EUR 501.41
  • EUR 237.00
  • EUR 1605.28
  • EUR 601.76
  • EUR 1103.52
  • EUR 398.00
  • EUR 3863.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8IWA6
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 45.6KDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Coiled Coil Domain Containing Protein 60 expressed in: E.coli

Recombinant Coiled Coil Domain Containing Protein 60 (CCDC60)

  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • EUR 660.00
  • EUR 1220.00
  • EUR 430.00
  • EUR 4300.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8C4J0
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Coiled Coil Domain Containing Protein 60 expressed in: E.coli

Recombinant Coiled Coil Domain Containing Protein 60 (CCDC60)

  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q3ZAV0
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 14.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Coiled Coil Domain Containing Protein 60 expressed in: E.coli

Human Coiled Coil Domain Containing Protein 60 (CCDC60) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Coiled Coil Domain Containing Protein 60 (CCDC60) Protein

  • EUR 759.00
  • EUR 300.00
  • EUR 2388.00
  • EUR 913.00
  • EUR 537.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rat Coiled Coil Domain Containing Protein 60 (CCDC60) Protein

  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Coiled Coil Domain Containing Protein 60 (CCDC60) Antibody (Biotin)

  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Coiled Coil Domain Containing Protein 60 (CCDC60) Antibody (Biotin)

  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rat Coiled coil domain containing protein 60(CCDC60) ELISA kit

E02C1090-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Coiled coil domain containing protein 60(CCDC60) ELISA kit

E02C1090-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Coiled coil domain containing protein 60(CCDC60) ELISA kit

E02C1090-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Coiled coil domain containing protein 60(CCDC60) ELISA kit

E06C1090-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Coiled coil domain containing protein 60(CCDC60) ELISA kit

E06C1090-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Coiled coil domain containing protein 60(CCDC60) ELISA kit

E06C1090-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Coiled coil domain containing protein 60(CCDC60) ELISA kit

E03C1090-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Coiled coil domain containing protein 60(CCDC60) ELISA kit

E03C1090-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Coiled coil domain containing protein 60(CCDC60) ELISA kit

E03C1090-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Coiled coil domain containing protein 60(CCDC60) ELISA kit

E04C1090-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Coiled coil domain containing protein 60(CCDC60) ELISA kit

E04C1090-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Coiled coil domain containing protein 60(CCDC60) ELISA kit

E04C1090-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Coiled coil domain containing protein 60(CCDC60) ELISA kit

E01C1090-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Coiled coil domain containing protein 60(CCDC60) ELISA kit

E01C1090-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Coiled coil domain containing protein 60(CCDC60) ELISA kit

E01C1090-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Coiled coil domain containing protein 60(CCDC60) ELISA kit

E07C1090-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Coiled coil domain containing protein 60(CCDC60) ELISA kit

E07C1090-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Coiled coil domain containing protein 60(CCDC60) ELISA kit

E07C1090-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Coiled coil domain containing protein 60(CCDC60) ELISA kit

E09C1090-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Coiled coil domain containing protein 60(CCDC60) ELISA kit

E09C1090-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Coiled coil domain containing protein 60(CCDC60) ELISA kit

E09C1090-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Coiled coil domain containing protein 60(CCDC60) ELISA kit

E08C1090-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Coiled coil domain containing protein 60(CCDC60) ELISA kit

E08C1090-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Coiled coil domain containing protein 60(CCDC60) ELISA kit

E08C1090-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CCDC60 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0377805 3 x 1.0 ug
EUR 376

Ccdc60 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7510805 3 x 1.0 ug
EUR 376

Ccdc60 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3628605 3 x 1.0 ug
EUR 376

Coiled Coil Domain Containing Protein 60 (CCDC60) Monoclonal Antibody (Rat)

  • EUR 284.00
  • EUR 3090.00
  • EUR 757.00
  • EUR 362.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: Ile127~Gly236
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Rat Coiled Coil Domain Containing Protein 60 (CCDC60)