CCDC60

CCDC60 antibody
70R-4198	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal CCDC60 antibody raised against the C terminal of CCDC60

CCDC60 siRNA
20-abx900848	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CCDC60 siRNA
20-abx910652	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CCDC60 siRNA
20-abx910653	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CCDC60 Blocking Peptide
33R-8088	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CCDC60 antibody, catalog no. 70R-4198

CCDC60 cloning plasmid
CSB-CL818242HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1653 Sequence: atgaccaaggttccagccaccaagaagcttcagagttcccccaactcgggggctgtccggcccttttatgcctcggagaacctaaggcaggtcccagacaagccaatgaagagcatcaagtatatggacaaggaaataataaacctcaaaaaggaccttatacgaagccgctttt Show more
Description: A cloning plasmid for the CCDC60 gene.

Human CCDC60 ELISA KIT
ELI-10788h	Lifescience Market	96 Tests	EUR 824

Rat CCDC60 shRNA Plasmid
20-abx990847	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human CCDC60 shRNA Plasmid
20-abx965910	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse CCDC60 shRNA Plasmid
20-abx983061	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse Ccdc60 ELISA KIT
ELI-50896m	Lifescience Market	96 Tests	EUR 865

CCDC60 Recombinant Protein (Human)
RP006001	ABM	100 ug	Ask for price

CCDC60 Recombinant Protein (Rat)
RP193517	ABM	100 ug	Ask for price

CCDC60 Recombinant Protein (Mouse)
RP121853	ABM	100 ug	Ask for price

Ccdc60 ORF Vector (Rat) (pORF)
ORF064507	ABM	1.0 ug DNA	EUR 506

CCDC60 ORF Vector (Human) (pORF)
ORF002001	ABM	1.0 ug DNA	EUR 95

Ccdc60 ORF Vector (Mouse) (pORF)
ORF040619	ABM	1.0 ug DNA	EUR 506

CCDC60 sgRNA CRISPR Lentivector set (Human)
K0377801	ABM	3 x 1.0 ug	EUR 339

Ccdc60 sgRNA CRISPR Lentivector set (Rat)
K7510801	ABM	3 x 1.0 ug	EUR 339

Ccdc60 sgRNA CRISPR Lentivector set (Mouse)
K3628601	ABM	3 x 1.0 ug	EUR 339

CCDC60 sgRNA CRISPR Lentivector (Human) (Target 1)
K0377802	ABM	1.0 ug DNA	EUR 154

CCDC60 sgRNA CRISPR Lentivector (Human) (Target 2)
K0377803	ABM	1.0 ug DNA	EUR 154

CCDC60 sgRNA CRISPR Lentivector (Human) (Target 3)
K0377804	ABM	1.0 ug DNA	EUR 154

Ccdc60 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7510802	ABM	1.0 ug DNA	EUR 154

Ccdc60 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7510803	ABM	1.0 ug DNA	EUR 154

Ccdc60 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7510804	ABM	1.0 ug DNA	EUR 154

Ccdc60 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3628602	ABM	1.0 ug DNA	EUR 154

Ccdc60 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3628603	ABM	1.0 ug DNA	EUR 154

Ccdc60 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3628604	ABM	1.0 ug DNA	EUR 154

CCDC60 Protein Vector (Mouse) (pPB-C-His)
PV162474	ABM	500 ng	EUR 603

CCDC60 Protein Vector (Mouse) (pPB-N-His)
PV162475	ABM	500 ng	EUR 603

CCDC60 Protein Vector (Mouse) (pPM-C-HA)
PV162476	ABM	500 ng	EUR 603

CCDC60 Protein Vector (Mouse) (pPM-C-His)
PV162477	ABM	500 ng	EUR 603

CCDC60 Protein Vector (Rat) (pPB-C-His)
PV258026	ABM	500 ng	EUR 603

CCDC60 Protein Vector (Rat) (pPB-N-His)
PV258027	ABM	500 ng	EUR 603

CCDC60 Protein Vector (Rat) (pPM-C-HA)
PV258028	ABM	500 ng	EUR 603

CCDC60 Protein Vector (Rat) (pPM-C-His)
PV258029	ABM	500 ng	EUR 603

CCDC60 Protein Vector (Human) (pPB-C-His)
PV008001	ABM	500 ng	EUR 329

CCDC60 Protein Vector (Human) (pPB-N-His)
PV008002	ABM	500 ng	EUR 329

CCDC60 Protein Vector (Human) (pPM-C-HA)
PV008003	ABM	500 ng	EUR 329

CCDC60 Protein Vector (Human) (pPM-C-His)
PV008004	ABM	500 ng	EUR 329

Ccdc60 3'UTR GFP Stable Cell Line
TU153315	ABM	1.0 ml	Ask for price

Ccdc60 3'UTR Luciferase Stable Cell Line
TU103315	ABM	1.0 ml	Ask for price

Ccdc60 3'UTR Luciferase Stable Cell Line
TU201812	ABM	1.0 ml	Ask for price

Ccdc60 3'UTR GFP Stable Cell Line
TU251812	ABM	1.0 ml	Ask for price

CCDC60 3'UTR GFP Stable Cell Line
TU053635	ABM	1.0 ml	EUR 1394

CCDC60 3'UTR Luciferase Stable Cell Line
TU003635	ABM	1.0 ml	EUR 1394

Coiled Coil Domain Containing Protein 60 (CCDC60) Antibody
20-abx104217	Abbexa	EUR 328.00 EUR 133.00 EUR 899.00 EUR 467.00 EUR 286.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Coiled Coil Domain Containing Protein 60 (CCDC60) Antibody
20-abx104218	Abbexa	EUR 481.00 EUR 133.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Coiled Coil Domain Containing Protein 60 (CCDC60) Antibody
20-abx104219	Abbexa	EUR 398.00 EUR 982.00 EUR 495.00 EUR 154.00 EUR 286.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

Coiled Coil Domain Containing Protein 60 (CCDC60) Antibody
20-abx128379	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

CCDC60 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV658747	ABM	1.0 ug DNA	EUR 682

CCDC60 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV658751	ABM	1.0 ug DNA	EUR 682

CCDC60 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV658752	ABM	1.0 ug DNA	EUR 682

Recombinant Coiled Coil Domain Containing Protein 60 (CCDC60)
4-RPU807Hu01	Cloud-Clone	EUR 501.41 EUR 237.00 EUR 1605.28 EUR 601.76 EUR 1103.52 EUR 398.00 EUR 3863.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q8IWA6 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 45.6KDa Isoelectric Point: Inquire
Description: Recombinant Human Coiled Coil Domain Containing Protein 60 expressed in: E.coli

Recombinant Coiled Coil Domain Containing Protein 60 (CCDC60)
4-RPU807Mu01	Cloud-Clone	EUR 548.00 EUR 250.00 EUR 1780.00 EUR 660.00 EUR 1220.00 EUR 430.00 EUR 4300.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q8C4J0 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 27.3kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Coiled Coil Domain Containing Protein 60 expressed in: E.coli

Recombinant Coiled Coil Domain Containing Protein 60 (CCDC60)
4-RPU807Ra01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q3ZAV0 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 14.1kDa Isoelectric Point: Inquire
Description: Recombinant Rat Coiled Coil Domain Containing Protein 60 expressed in: E.coli

Human Coiled Coil Domain Containing Protein 60 (CCDC60) Protein
20-abx166165	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Coiled Coil Domain Containing Protein 60 (CCDC60) Protein
20-abx065993	Abbexa	EUR 759.00 EUR 300.00 EUR 2388.00 EUR 913.00 EUR 537.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Rat Coiled Coil Domain Containing Protein 60 (CCDC60) Protein
20-abx065994	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Coiled Coil Domain Containing Protein 60 (CCDC60) Antibody (Biotin)
20-abx272905	Abbexa	EUR 467.00 EUR 244.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Coiled Coil Domain Containing Protein 60 (CCDC60) Antibody (Biotin)
20-abx273385	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Rat Coiled coil domain containing protein 60(CCDC60) ELISA kit
E02C1090-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Coiled coil domain containing protein 60(CCDC60) ELISA kit
E02C1090-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Coiled coil domain containing protein 60(CCDC60) ELISA kit
E02C1090-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Coiled coil domain containing protein 60(CCDC60) ELISA kit
E06C1090-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Coiled coil domain containing protein 60(CCDC60) ELISA kit
E06C1090-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Coiled coil domain containing protein 60(CCDC60) ELISA kit
E06C1090-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Coiled coil domain containing protein 60(CCDC60) ELISA kit
E03C1090-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Coiled coil domain containing protein 60(CCDC60) ELISA kit
E03C1090-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Coiled coil domain containing protein 60(CCDC60) ELISA kit
E03C1090-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Coiled coil domain containing protein 60(CCDC60) ELISA kit
E04C1090-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Coiled coil domain containing protein 60(CCDC60) ELISA kit
E04C1090-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Coiled coil domain containing protein 60(CCDC60) ELISA kit
E04C1090-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Coiled coil domain containing protein 60(CCDC60) ELISA kit
E01C1090-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Coiled coil domain containing protein 60(CCDC60) ELISA kit
E01C1090-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Coiled coil domain containing protein 60(CCDC60) ELISA kit
E01C1090-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Coiled coil domain containing protein 60(CCDC60) ELISA kit
E07C1090-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Coiled coil domain containing protein 60(CCDC60) ELISA kit
E07C1090-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Coiled coil domain containing protein 60(CCDC60) ELISA kit
E07C1090-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Coiled coil domain containing protein 60(CCDC60) ELISA kit
E09C1090-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Coiled coil domain containing protein 60(CCDC60) ELISA kit
E09C1090-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Coiled coil domain containing protein 60(CCDC60) ELISA kit
E09C1090-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Coiled coil domain containing protein 60(CCDC60) ELISA kit
E08C1090-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Coiled coil domain containing protein 60(CCDC60) ELISA kit
E08C1090-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Coiled coil domain containing protein 60(CCDC60) ELISA kit
E08C1090-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Coiled coil domain containing protein 60(CCDC60) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CCDC60 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0377805	ABM	3 x 1.0 ug	EUR 376

Ccdc60 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7510805	ABM	3 x 1.0 ug	EUR 376

Ccdc60 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3628605	ABM	3 x 1.0 ug	EUR 376

Coiled Coil Domain Containing Protein 60 (CCDC60) Monoclonal Antibody (Rat)
4-MAU807Ra21	Cloud-Clone	EUR 284.00 EUR 3090.00 EUR 757.00 EUR 362.00 EUR 229.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ile127~Gly236 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Rat Coiled Coil Domain Containing Protein 60 (CCDC60)