BGLAP

Bglap Antibody
1-CSB-PA002682DA01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Bglap. Recognizes Bglap from Rat. This antibody is Unconjugated. Tested in the following application: ELISA

BGLAP Antibody
1-CSB-PA11834A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BGLAP. Recognizes BGLAP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

BGLAP Antibody
1-CSB-PA135204
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BGLAP. Recognizes BGLAP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

BGLAP Antibody
1-CSB-PA944463
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BGLAP. Recognizes BGLAP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

BGLAP Antibody
1-CSB-PA434737
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BGLAP. Recognizes BGLAP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

BGLAP Antibody
1-CSB-PA277795
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BGLAP. Recognizes BGLAP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

BGLAP siRNA
20-abx900629
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BGLAP siRNA
20-abx909076
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BGLAP siRNA
20-abx909077
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BGLAP Rabbit pAb
A1530-100ul 100 ul
EUR 308

BGLAP Rabbit pAb
A1530-200ul 200 ul
EUR 459

BGLAP Rabbit pAb
A1530-20ul 20 ul Ask for price

BGLAP Rabbit pAb
A1530-50ul 50 ul Ask for price

BGLAP Rabbit pAb
A14636-100ul 100 ul
EUR 308

BGLAP Rabbit pAb
A14636-200ul 200 ul
EUR 459

BGLAP Rabbit pAb
A14636-20ul 20 ul
EUR 183

BGLAP Rabbit pAb
A14636-50ul 50 ul
EUR 223

Mouse Osteocalcin (Bglap)
1-CSB-EP002682MO
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 21.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Osteocalcin(Bglap) expressed in E.coli

Rat Osteocalcin (Bglap)
1-CSB-EP002682RA
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 32.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Osteocalcin(Bglap) expressed in E.coli

PMF1-BGLAP Protein
20-abx261202
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

BGLAP Conjugated Antibody
C36774 100ul
EUR 397

Osteocalcin (BGLAP) Antibody
abx411101-02mg 0.2 mg
EUR 592
  • Shipped within 1 week.

Osteocalcin (BGLAP) Antibody
abx411102-02mg 0.2 mg
EUR 565
  • Shipped within 1 week.

Osteocalcin (BGLAP) Antibody
abx411103-02mg 0.2 mg
EUR 565
  • Shipped within 1 week.

Osteocalcin (BGLAP) Antibody
abx411104-02mg 0.2 mg
EUR 565
  • Shipped within 1 week.

Osteocalcin (BGLAP) Antibody
abx411105-02mg 0.2 mg
EUR 592
  • Shipped within 1 week.

Osteocalcin (BGLAP) Antibody
abx411529-025ml 0.25 ml
EUR 704
  • Shipped within 1 week.

Osteocalcin (BGLAP) Antibody
abx411530-1ml 1 ml
EUR 439
  • Shipped within 1 week.

Osteocalcin (BGLAP) Antibody
abx411531-01ml 0.1 ml
EUR 439
  • Shipped within 1 week.

BGLAP-RS1 siRNA
20-abx909075
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BGLAP cloning plasmid
CSB-CL002682HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 303
  • Sequence: ATGAGAGCCCTCACACTCCTCGCCCTATTGGCCCTGGCCGCACTTTGCATCGCTGGCCAGGCAGGTGCGAAGCCCAGCGGTGCAGAGTCCAGCAAAGGTGCAGCCTTTGTGTCCAAGCAGGAGGGCAGCGAGGTAGTGAAGAGACCCAGGCGCTACCTGTATCAATGGCTGGGAGC
  • Show more
Description: A cloning plasmid for the BGLAP gene.

Bglap Polyclonal Antibody
A57033 100 µg
EUR 570.55
Description: reagents widely cited

BGLAP Rabbit pAb
A6205-100ul 100 ul
EUR 308

BGLAP Rabbit pAb
A6205-200ul 200 ul
EUR 459

BGLAP Rabbit pAb
A6205-20ul 20 ul
EUR 183

BGLAP Rabbit pAb
A6205-50ul 50 ul
EUR 223

BGLAP Polyclonal Antibody
A52249 100 µg
EUR 570.55
Description: reagents widely cited

BGLAP Rabbit pAb
A18241-100ul 100 ul
EUR 308

BGLAP Rabbit pAb
A18241-200ul 200 ul
EUR 459

BGLAP Rabbit pAb
A18241-20ul 20 ul
EUR 183

BGLAP Rabbit pAb
A18241-50ul 50 ul
EUR 223

Anti-BGLAP antibody
STJ11100198 100 µl
EUR 277
Description: This gene encodes a highly abundant bone protein secreted by osteoblasts that regulates bone remodeling and energy metabolism. The encoded protein contains a Gla (gamma carboxyglutamate) domain, which functions in binding to calcium and hydroxyapatite, the mineral component of bone. Serum osteocalcin levels may be negatively correlated with metabolic syndrome. Read-through transcription exists between this gene and the neighboring upstream gene, PMF1 (polyamine-modulated factor 1), but the encoded protein only shows sequence identity with the upstream gene product.

Anti-BGLAP antibody
STJ27961 100 µl
EUR 277
Description: This gene encodes a highly abundant bone protein secreted by osteoblasts that regulates bone remodeling and energy metabolism. The encoded protein contains a Gla (gamma carboxyglutamate) domain, which functions in binding to calcium and hydroxyapatite, the mineral component of bone. Serum osteocalcin levels may be negatively correlated with metabolic syndrome. Read-through transcription exists between this gene and the neighboring upstream gene, PMF1 (polyamine-modulated factor 1), but the encoded protein only shows sequence identity with the upstream gene product.

Anti-BGLAP antibody
STJ116843 100 µl
EUR 277
Description: This gene encodes a highly abundant bone protein secreted by osteoblasts that regulates bone remodeling and energy metabolism. The encoded protein contains a Gla (gamma carboxyglutamate) domain, which functions in binding to calcium and hydroxyapatite, the mineral component of bone. Serum osteocalcin levels may be negatively correlated with metabolic syndrome. Read-through transcription exists between this gene and the neighboring upstream gene, PMF1 (polyamine-modulated factor 1), but the encoded protein only shows sequence identity with the upstream gene product.

Anti-BGLAP Antibody
STJ502017 100 µg
EUR 476

Anti-BGLAP antibody
STJ22794 100 µl
EUR 277
Description: This gene encodes a highly abundant bone protein secreted by osteoblasts that regulates bone remodeling and energy metabolism. The encoded protein contains a Gla (gamma carboxyglutamate) domain, which functions in binding to calcium and hydroxyapatite, the mineral component of bone. Serum osteocalcin levels may be negatively correlated with metabolic syndrome. Read-through transcription exists between this gene and the neighboring upstream gene, PMF1 (polyamine-modulated factor 1), but the encoded protein only shows sequence identity with the upstream gene product.

Bglap Antibody, HRP conjugated
1-CSB-PA002682DB01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Bglap. Recognizes Bglap from Rat. This antibody is HRP conjugated. Tested in the following application: ELISA

Bglap Antibody, FITC conjugated
1-CSB-PA002682DC01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Bglap. Recognizes Bglap from Rat. This antibody is FITC conjugated. Tested in the following application: ELISA

Bglap Antibody, Biotin conjugated
1-CSB-PA002682DD01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Bglap. Recognizes Bglap from Rat. This antibody is Biotin conjugated. Tested in the following application: ELISA

BGLAP Antibody, HRP conjugated
1-CSB-PA11834B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BGLAP. Recognizes BGLAP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

BGLAP Antibody, FITC conjugated
1-CSB-PA11834C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BGLAP. Recognizes BGLAP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

BGLAP Antibody, Biotin conjugated
1-CSB-PA11834D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BGLAP. Recognizes BGLAP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Polyclonal BGLAP Antibody (Center)
AMM08600G 0.1ml
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BGLAP (Center). This antibody is tested and proven to work in the following applications:

Human BGLAP ELISA Kit
ELA-E0471h 96 Tests
EUR 824

Rat BGLAP shRNA Plasmid
20-abx984902
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse BGLAP shRNA Plasmid
20-abx969349
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human BGLAP shRNA Plasmid
20-abx950428
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-Osteocalcin/BGLAP Antibody
PB9088 100ug/vial
EUR 334

Anti-Osteocalcin/BGLAP Antibody
PB9918 100ug/vial
EUR 334

Anti-Osteocalcin/BGLAP Antibody
PB9919 100ug/vial
EUR 334

Anti-Osteocalcin/BGLAP Antibody
PB9920 100ug/vial
EUR 334

BGLAP Recombinant Protein (Human)
RP036994 100 ug Ask for price

BGLAP Recombinant Protein (Rat)
RP192146 100 ug Ask for price

BGLAP Recombinant Protein (Mouse)
RP119513 100 ug Ask for price

BGLAP Recombinant Protein (Mouse)
RP119516 100 ug Ask for price

Human BGLAP ELISA Kit
STJ150141 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of OC/BGP in human serum, plasma and other biological fluids

Mouse BGLAP ELISA Kit
STJ150166 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of OC/BGP in Mouse serum, plasma and other biological fluids

Rat BGLAP ELISA Kit
STJ150184 1 kit
EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of OC/BGP in Rat serum, plasma and other biological fluids

Anti-BGLAP Antibody (Biotin)
STJ502018 100 µg
EUR 586

Anti-BGLAP Antibody (FITC)
STJ502019 100 µg
EUR 586

Chicken BGLAP/ Osteocalcin ELISA Kit
E0006Ch 1 Kit
EUR 717

Dog BGLAP/ Osteocalcin ELISA Kit
E0012Do 1 Kit
EUR 717

Pig BGLAP/ Osteocalcin ELISA Kit
E0024Pi 1 Kit
EUR 717

Bovine BGLAP/ Osteocalcin ELISA Kit
E0036Bo 1 Kit
EUR 717

Rat Bglap/ Osteocalcin ELISA Kit
E0125Ra 1 Kit
EUR 571

Mouse Bglap/ Osteocalcin ELISA Kit
E0176Mo 1 Kit
EUR 571

Human BGLAP/ Osteocalcin ELISA Kit
E0272Hu 1 Kit
EUR 571

PMF1-BGLAP protein (His tag)
80R-3550 100 ug
EUR 327
Description: Purified recombinant PMF1-BGLAP protein (His tag)

Rat Osteocalcin (BGLAP) ELISA Kit
abx051840-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Pig Osteocalcin (BGLAP) ELISA Kit
abx051841-96tests 96 tests
EUR 754
  • Shipped within 5-10 working days.

Chicken Osteocalcin (BGLAP) ELISA Kit
20-abx150050
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Cow Osteocalcin (BGLAP) ELISA Kit
20-abx150176
  • EUR 7645.00
  • EUR 4074.00
  • EUR 942.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Dog Osteocalcin (BGLAP) ELISA Kit
20-abx150283
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Osteocalcin (BGLAP) ELISA Kit
20-abx155931
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Osteocalcin (BGLAP) ELISA Kit
20-abx154491
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Pig Osteocalcin (BGLAP) ELISA Kit
20-abx154987
  • EUR 7645.00
  • EUR 4074.00
  • EUR 942.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rabbit Osteocalcin (BGLAP) ELISA Kit
20-abx155095
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Osteocalcin (BGLAP) ELISA Kit
20-abx152600
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Osteocalcin (BGLAP) ELISA Kit
abx254305-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Osteocalcin (BGLAP) ELISA Kit
abx255867-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.