BCS1L antibody

31919-100ul 100ul
EUR 252

BCS1L antibody

31919-50ul 50ul
EUR 187

BCS1L Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against BCS1L. Recognizes BCS1L from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

BCS1L Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against BCS1L. Recognizes BCS1L from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

BCS1L Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against BCS1L. Recognizes BCS1L from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

BCS1L Antibody

DF12189 200ul
EUR 304
Description: BCS1L antibody detects endogenous levels of BCS1L.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA10458 50 ul
EUR 363
Description: Mouse polyclonal to BCS1L


YF-PA10459 100 ug
EUR 403
Description: Rabbit polyclonal to BCS1L

BCS1L Polyclonal Antibody

30996-100ul 100ul
EUR 252

BCS1L Polyclonal Antibody

30996-50ul 50ul
EUR 187

BCS1L cloning plasmid

CSB-CL897463HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1260
  • Sequence: atgccactttcagactttattctggctctgaaggacaatccctactttggggctggatttgggctggtgggtgtgggcacagccctggccctggcccggaagggtgtccaactgggcctggtggcattccggcgccattacatgatcacactggaagtccctgctcgagacagga
  • Show more
Description: A cloning plasmid for the BCS1L gene.

BCS1L Blocking Peptide

DF12189-BP 1mg
EUR 195

BCS1L Rabbit pAb

A7647-100ul 100 ul
EUR 308

BCS1L Rabbit pAb

A7647-200ul 200 ul
EUR 459

BCS1L Rabbit pAb

A7647-20ul 20 ul
EUR 183

BCS1L Rabbit pAb

A7647-50ul 50 ul
EUR 223

anti- BCS1L antibody

FNab00856 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: BCS1-like (yeast)
  • Uniprot ID: Q9Y276
  • Gene ID: 617
  • Research Area: Metabolism
Description: Antibody raised against BCS1L

anti- BCS1L antibody

FNab00857 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • IF: 1:20-1:200
  • Immunogen: BCS1-like(yeast)
  • Uniprot ID: Q9Y276
  • Gene ID: 617
  • Research Area: Metabolism
Description: Antibody raised against BCS1L

Anti-BCS1L antibody

PAab00856 100 ug
EUR 386

Anti-BCS1L antibody

STJ29961 100 µl
EUR 277
Description: This gene encodes a homolog of the S. cerevisiae bcs1 protein which is involved in the assembly of complex III of the mitochondrial respiratory chain. The encoded protein does not contain a mitochondrial targeting sequence but experimental studies confirm that it is imported into mitochondria. Mutations in this gene are associated with mitochondrial complex III deficiency and the GRACILE syndrome. Several alternatively spliced transcripts encoding two different isoforms have been described.

Anti-BCS1L (5F3)

YF-MA10092 100 ug
EUR 363
Description: Mouse monoclonal to BCS1L


EF008098 96 Tests
EUR 689

Mouse BCS1L shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

BCS1L Polyclonal Conjugated Antibody

C31919 100ul
EUR 397

BCS1L Polyclonal Conjugated Antibody

C30996 100ul
EUR 397

Human BCS1L shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

BCS1L Recombinant Protein (Human)

RP002971 100 ug Ask for price

BCS1L Recombinant Protein (Rat)

RP192074 100 ug Ask for price

BCS1L Recombinant Protein (Mouse)

RP119393 100 ug Ask for price

Mitochondrial Chaperone BCS1 (BCS1L) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mitochondrial Chaperone BCS1 (BCS1L) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mitochondrial Chaperone BCS1 (BCS1L) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mitochondrial Chaperone BCS1 (BCS1L) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mitochondrial Chaperone BCS1 (BCS1L) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mitochondrial Chaperone BCS1 (BCS1L) Antibody

abx230856-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Mitochondrial Chaperone BCS1 (BCS1L) Antibody

abx230857-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Bcs1l ORF Vector (Rat) (pORF)

ORF064026 1.0 ug DNA
EUR 506

BCS1L ORF Vector (Human) (pORF)

ORF000991 1.0 ug DNA
EUR 95

Bcs1l ORF Vector (Mouse) (pORF)

ORF039799 1.0 ug DNA
EUR 506

BCS1L ELISA Kit (Human) (OKCA00729)

OKCA00729 96 Wells
EUR 833
Description: Description of target: Chaperone necessary for the assembly of mitochondrial respiratory chain complex III. Plays an important role in the maintenance of mitochondrial tubular networks, respiratory chain assembly and formation of the LETM1 complex.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.95 pg/mL

Bcs1l sgRNA CRISPR Lentivector set (Rat)

K7563501 3 x 1.0 ug
EUR 339

Bcs1l sgRNA CRISPR Lentivector set (Mouse)

K3333101 3 x 1.0 ug
EUR 339

BCS1L sgRNA CRISPR Lentivector set (Human)

K0178401 3 x 1.0 ug
EUR 339

Bovine Mitochondrial chaperone BCS1, BCS1L ELISA KIT

ELI-10939b 96 Tests
EUR 928

Human Mitochondrial chaperone BCS1, BCS1L ELISA KIT

ELI-24484h 96 Tests
EUR 824

Human Mitochondrial chaperone BCS1(BCS1L) ELISA kit

CSB-EL002644HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Mitochondrial chaperone BCS1 (BCS1L) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Mitochondrial chaperone BCS1(BCS1L) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Mitochondrial chaperone BCS1(BCS1L) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Monoclonal BCS1L Antibody (monoclonal) (M01), Clone: 5F3

APG02265G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human BCS1L (monoclonal) (M01). The antibodies are raised in mouse and are from clone 5F3. This antibody is applicable in WB